Table 1.
Quantitative RT-PCR NVGII assay and pooled standard curves
| Target | Gene | Primer/probe* | Primer/probe sequence (5′ to 3′)† | Primer/probe ref | Product size (nucleotide) | Annealing temperature | Pooled curve slope, intercept (R2)‡ | qPCR efficiency |
|---|---|---|---|---|---|---|---|---|
| NVGII | OFR1-OFR2 junction | QNIF2d | ATGTTCAGRTGGATGAGRTTCTCWGA | 30 | 88 | 60°C | −3.313, 37.603 (99.5%) | 100.36% |
| COG2R | TCGACGCCATCTTCATTCACA | 31 | ||||||
| QNIFSP | FAM-AGCACGTGGGAGGGCGATCG-TAMRA | 31 |
RT-PCR = reverse transcriptase polymerase chain reactions; NVGII = norovirus GII.
*
F denotes sense primer, R denotes antisense primer, and P is hydrolysis probe sequence.
†
Mixed bases in degenerate primers and probe are as follows: R, A, or G; W, A, or T. The TaqMan probe was labeled at the 5′ end with the reporter dye FAM (6-carboxyfluorescein) and at the 3′ end with the quencher dye TAMRA (6-carboxytetramethyl-rhodamine).
‡
Concentrations were determined with the following formula: Ct = slope × log10 (concentration) + y-intercept. PCR efficiency = 10−1/slope + 1.