Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for the construction of the L. pneumophila ΔlpdA strain ICC1080
| Function | Primer sequence (5′–3′) | Source |
|---|---|---|
| Amplification of the 5′-flanking region | CATAATGACAGGTAAGGCTTC | This study |
| CAGTGGGTACCGATTCACTCATAAATTAATTTTACCTAAT | ||
| Amplification of the 3′-flanking region | GCGACTCTAGATTTTAGGCTGTTTTGATCAAGCC | This study |
| ATCTCAATTACAGGAAATGCAAAC | ||
| Sequencing of the lpdA genomic region | CTTGCCATGTTCTGCTATATATTTC | This study |
| GTGATATTGTATGCACTTCCATC |
