Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers designed for amplification of a conserved region of mitochondrial cytochrome-b gene
| Sl. No. | Primer | Direction | Sequence | Target | Length | Tm °C | Amplicon |
|---|---|---|---|---|---|---|---|
| 1. | VPH-F | Forward | ATCCGACACAACAACAGCATTCTCCT | Mt cyt-b gene | 26 bp | 60.9 | 609 bp |
| 2. | VPH-R | Reverse | GCTGGGGTGTAGTTGTCTGGGTCTC | Mt cyt-b gene | 25 bp | 60.9 |
