Abstract
The transcription factor ZEB1 is normally not expressed in epithelial cells. When inappropriately expressed in carcinomas, ZEB1 initiates epithelial to mesenchymal transition due to its ability to repress E-cadherin and other genes involved in polarity. Recently, ZEB1 and ZEB2 have been identified as direct targets of the microRNA-200c family. We find that miR-200c levels are high in well-differentiated endometrial, breast and ovarian cancer cell lines, but extremely low in poorly-differentiated cancer cells. Low or absent miR-200c results in aberrant expression of ZEB1 and consequent repression of E-cadherin. Reinstatement of miR-200c to such cells restores E-cadherin and dramatically reduces migration and invasion. Microarray profiling reveals that in addition to ZEB1 and ZEB2, other mesenchymal genes (such as FN1, NTRK2, and QKI), which are also predicted direct targets of miR-200c, are indeed inhibited by addition of exogenous miR-200c. One such gene, class IIIβ-tubulin (TUBB3), which encodes a tubulin isotype normally found only in neuronal cells, is a direct target of miR-200c. This finding is of particular significance because we show that restoration of miR-200c increases sensitivity to microtubule-targeting agents by up to 85%. Since expression of TUBB3 is a common mechanism of resistance to microtubule-binding chemotherapeutic agents in many types of solid tumors, the ability of miR-200c to restore chemosensitivity to such agents may be explained by its ability to reduce TUBB3. Because miR-200c is crucial for maintenance of epithelial identity, behavior, and sensitivity to chemotherapy, we propose that it warrants further investigation as a therapeutic strategy for aggressive, drug-resistant cancers.
Keywords: miRNA, ZEB1, EMT, invasion, chemosensitivity
Introduction
We previously reported that the transcription factor ZEB1, (Zinc finger E-box binding homeobox 1, also known as TCF8, ZFHX1A, ZFHEP, AREB6, BZP, NIL-2-A, and δEF1), is aberrantly expressed in Type 2 endometrial cancers that have undergone an epithelial to mesenchymal transition (EMT) (1, 2). ZEB1 binds to E-box like sequences (CACCTG) and is involved in development of mesodermal and neural tissues. ZEB1 and ZEB2 (SIP1) play a role in EMT during tumor progression by directly repressing E-cadherin (3–5) and other epithelial markers (6, 7). Endometrial cancers can be divided into two subtypes. Type 1 endometrial cancers (low grade endometrioid adenocarcinomas) retain many epithelial characteristics and are relatively non-aggressive. In contrast, Type 2 comprises a heterogeneous group of poorly differentiated tumors (FIGO grade 3 endometrioid adenocarcinomas, serous papillary, clear cell, and malignant mixed Müllerian tumors) with advanced stage at diagnosis and poor prognosis as compared to Type 1 tumors (8, 9). Type 2 tumors often have lost epithelial markers and gained mesenchymal characteristics, and this affects their clinical behavior (aggressiveness). Some have suggested that a similar classification for ovarian cancers would be useful (10–12).
Recent research has implicated microRNAs (miRNAs), acting as oncogenes and tumor suppressors, in the development and progression of cancers (13, 14). Many miRNAs localize to fragile sites and are frequently lost in cancer (15). Recently, it was reported that miR-200c targets ZEB1 (16). It was later shown that other members of the miR-200 family, which share sequence homology, can target both ZEB1 and the closely related gene, ZEB2 (17, 18). These recent data suggest that the miR-200 family is responsible for maintenance of the epithelial phenotype at least partially via repression of ZEB1 and ZEB2. Indeed, we demonstrate that miR-200c expression is strongly associated with a more benign, less aggressive phenotype in endometrial, ovarian and breast cancer cell lines. Levels inversely correlate with ZEB1 and positively correlate with E-cadherin. We demonstrate that restoration of miR-200c expression to cancer cells that lack it, suppresses ZEB1 expression, thereby completely restoring E-cadherin. We find that reinstatement of miR-200c leads to a dramatic decrease in cell migration and invasion and an up to 85% increase in sensitivity to microtubule-targeting chemotherapeutic agents. We suspected that, just as miR-200c indirectly maintains E-cadherin expression by directly repressing ZEB1 and ZEB2, it also likely targets other genes involved in polarity, migratory capacity, and chemosensitivity. Consequently, we performed expression profiling to identify additional genes altered by restoration of miR-200c to cancer cells. Indeed we find that miR-200c inhibits a program of mesenchymal markers, in addition to ZEBs. We demonstrate that one such gene, class IIIβ-tubulin (TUBB3), a microtubule component normally found only in neuronal cells, is a direct target of miR-200c. Since expression of TUBB3 is a prevalent mechanism of resistance to microtubule-binding chemotherapeutic agents in many solid tumors, the fact that TUBB3 is reduced by miR-200c may account for the dramatic effect of restoration of miR-200c expression on sensitivity to this clinically-important class of chemotherapeutic agents.
Materials and Methods
Cell Culture
Hec50 cells, which well represent the more aggressive Type II endometrial cancers (19), were cultured in DMEM with 10% FBS, and 2 mM L-glutamine. AN3CA cells (ATCC), derived from a grade 3 endometrioid adenocarcinoma (also an aggressive form of endometrial cancer and thought to represent the characteristics of Type 2 endometrial cancers) and Ishikawa cells (representing a low-grade endometrioid adenocarcinoma, or Type 1 tumor) (19) were grown in MEM with 5% FBS, NEAA and 1 nM insulin. EEC B37 cells are normal endometrial epithelial cells that have been immortalized with hTERT (20), and were maintained in F12 MEM containing 10% FBS, 2 mM L-glutamine and 160 ng/ml insulin. HIESC are normal endometrial stromal cells transformed with SV40 large T antigen (21) and were grown in RPMI with 10% FBS, penicillin, streptomycin and sodium pyruvate. MCF-7 and T47D breast cancer cells were grown in DMEM, 10% FBS, and L-glutamine. BT-474 cells were grown as above, with the addition of NEAA and insulin. MDA-MB-231 and ZR75 cells were grown in media containing 5% FBS, HEPES, NEAA, L-glutamine, penicillin, streptomycin and insulin. BT-549 cells were grown in RPMI supplemented with 10% FBS and insulin. The MCF-7, T47D, ZR75 and BT-474 are all relatively well-differentiated breast cancer cell lines that retain estrogen receptors and the epithelial marker E-cadherin. In contrast, MDA-MB-231 and BT-549 cells represent less-differentiated breast cancers negative for estrogen receptors and E-cadherin. All of the ovarian cell lines (2008, Hey, SKOV3, OVCA 420 and OVCA 433) were grown in RPMI with 10% FBS. All cells were grown in a 37°C incubator with 5% CO2. The identity of all the cell lines was confirmed by DNA profiling using the Identifiler Kit from Applied Biosystems (Foster City, CA).
Immunoblotting
Whole cell protein extracts were denatured and 50 μg separated on 8% SDS PAGE gels and transferred to PVDF membranes. After blocking in 5% milk in TBS-T, membranes were probed overnight at 4°C. Primary antibodies utilized include: ZEB1 (rabbit polyclonal from Dr. Doug Darling, University of Kentucky, 1:1500 dilution), E-cadherin (clone NCH-38 from DAKO, 1μg/ml), N-cadherin (clone 13A9 from Upstate, 1:5000 dilution), Vimentin (clone V9 from Sigma, 1:2000 dilution), TUBB3 (clone SDL.3D10 from Sigma, 1:400 dilution), PSTAIR (rabbit polyclonal from Upstate, 1μg/ml dilution) and α-tubulin (clone B-5-1-2 from Sigma, 1:15000 dilution). After incubation with appropriate secondary antibody, results were detected using Western Lightning Chemiluminescence Reagent Plus (Perkin Elmer).
Real Time RT-PCR
RNA was harvested from cells using Trizol (Invitrogen). Prior to generating cDNA, mRNA was treated with DNase1 (Invitrogen) for 15 minutes at room temperature. RNA was reverse transcribed into cDNA in a reaction containing reaction buffer, 10 mM DTT, 1 mM dNTPs, RNAse inhibitor (Promega), random hexamers (250 ng) and 200 U of MMLV-RT (ABI). The reaction proceeded at 25°C for 10 minutes, then at 37°C for one hour. For normalization, real time RT-PCR was performed on the cDNA using eukaryotic 18S rRNA endogenous control primers and FAM-MGB probe (ABI). TaqMan MicroRNA Reverse Transcription kit was used to generate cDNA for real time RT-PCR reaction in conjunction with a miR-200c specific primer and probe (ABI, assay ID 002300). The reverse transcription primer for miR-200c is a hairpin primer which is specific for the mature miRNA and will not bind to the precursor molecules. Reported values are the means and standard errors of 3 or 4 biological replicates, as indicated. For validation of the microarray data, SYBR green real time RT-PCR was performed using primers specific for CHK2 (forward 5′-GCTCTTGGCTGTGCAGATTA-3′, reverse 5′-ACGGTTATACCCAGCAGTCC-3′), ARHGDIB (forward 5′-CTGGGTCCCTCTTCAACACT-3′, reverse 5′-TGTTCTAGGGACCACGTTGA-3′), MAL2 (forward 5′-GCAGCCACTCCTGAGTGATA-3′, reverse 5′-CGTAAAGCCAGACCCAAACT-3′), EPHB1 (forward 5′-GTGAGATGGACAGCTCCAGA-3′, reverse 5′-ACGATCCCATAGCTCCAAAC-3′), LEPR (forward 5′-ATTGGAGCAATCCAGCCTAC-3′, reverse 5′-CAGGGGCTTCCAAAGTAAAG-3′) and ST6GALNAC5 (forward 5′-TGAGCTCTTCAAGCAGGAGA-3′, reverse 5′-CATTGTAAACCAGCCAGTGC-3′) and TUBB3 (forward 5′-CGAAGCCAGCAGTGTCTAAA-3′, reverse 5′-GGAGGACGAGGCCATAAATA-3′). To avoid the possibility of amplification artifacts, the PCR products for all SYBR green primer pairs were verified by gel electrophoresis to be single products.
The relative mRNA or miRNA levels were calculated using the comparative Ct method (ΔΔCt). Briefly, the Ct (cycle threshold) values for the rRNA or actin were subtracted from Ct values of the target gene to achieve the ΔCt value. The 2−ΔCt was calculated for each sample and then each of the values was then divided by a control sample to achieve the relative mRNA or miRNA levels (ΔΔCt).
Transfection, Migration and Invasion Assays
Lipofectamine 2000 (Invitrogen) was incubated with pre-200c (miRNA mimic) or scrambled negative control (Ambion) at a concentration of 60 nM incubated in serum free DMEM for 20 minutes prior to addition to Hec50 cells. Cells were incubated at 37°C for 4 hours before replacement of FBS to 10%. Protein and RNA were harvested 48 hours post transfection. For wound healing assay, 24 hours post transfection, cells were trypsinized and plated into 6-well dishes in triplicate at high density. The next day a wound was made through the cells using a p200 tip. Pictures were taken immediately and then 4, 8, 12 and 24 hours later. For migration and invasion assays, 36 hours post transfection cells were serum starved for 12 hours prior to performing the assay. BD BioCoat Control Insert Chambers 24-well plate with 8 micron pore size and BD BioCoat Matrigel Invasion Chambers were used for migration and invasion assays respectively. After starvation, cells were trypsinized and 2.5 × 104 cells were plated in 0.5 ml MEM with 0.5% FBS in the upper chamber. In the lower chamber 0.8mL of 50% conditioned media from Hec50 cells plus 50% DMEM with 10% FBS, and L-glutamine was used as an attractant. Cells were incubated for 48 hours at 37°C. Migrating or invading cells on the lower surface of the membranes were stained with Diff-Quik stain (Fisher) and counted manually using ImagePro Plus software (Mediacybernetics Inc.).
Fluorescent Immunocytochemistry
Cells were grown on glass coverslips, rinsed with PBS, and fixed with 10% neutral buffered formalin for 5 minutes, followed by 50% ethanol for 4 minutes. Coverslips were rinsed again with PBS and stored dry at −20°C. Before staining, coverslips were thawed at room temperature and rinsed with TBS-T (0.05%). ZEB1 antibody was used at a 1:1000 dilution and E-cadherin at 1:50. Staining was performed as described previously (1).
Cell Death ELISAs
Hec50 cells were transfected as described above. Twenty-four hours after transfection, cells were treated with 0, 5, 10, 15, 20 or 25 nM paclitaxel (Sigma); or 0, 20, 30, 40 or 50 μM cisplatin (cis-diamminedichloridoplatinum(II) (Sigma). In separate experiments Hec50 (endometrial cancer), MDA-MB-231 (breast cancer), and Hey (ovarian cancer) cell lines were treated with 50 ng/ml TRAIL, 125 ng/ml (R&D Systems, Minneapolis, MN), FasL, 1μg/ml (Axxora Life Sciences Inc, San Diego, CA) doxorubicin, 6 μg/ml (Calbiochem, San Diego, CA) mitomycin C (Sigma), 100 nM vincristine (Sigma) or 100 nM epothilone B (Sigma). Twenty four hours after treatment, the Cell Death ELISA (Roche) which recognizes mono- and oligonucleosomes in the cytoplasm of dying cells was performed as per manufacturer’s instructions.
Statistical Analysis
For the real time PCR, cell death ELISA and luciferase assays, a Student’s paired t-test was performed to determine statistical significance (Microsoft Excel). Values were considered to be statistically significant if the p-value was equal to or less than 0.05.
Microarray Analysis
To confirm the integrity of triplicate RNA samples, RNA-nano chips were run on a Bioanalyzer (Agilent). The cDNA was generated and processed according to the GeneChip Expression Analysis Technical Manual (Affymetrix). Labeled complementary RNA was made using the GeneChip_IVT Labeling Kit (Affymetrix), fragmented, and hybridized to HGU133 Plus 2.0 Affymetrix oligonucleotide microarray chips, which contain over 54000 probe sets. GeneSpring GX 9.0 (Agilent) software was used for analysis and clustering of array data. Data was filtered using a 1.5 fold change cutoff and a p-value of 0.05 (ANOVA, with Benjamini Hochberg FDR multiple testing correction). Ingenuity Pathway Analysis software (Ingenuity Systems) was utilized to determine which pathways are highly represented among the genes that change in response to miR-200c.
Luciferase Assays
A 262 bp section of the 3′ UTR of TUBB3 containing the putative binding site for miR-200c (predicted from the TargetScan database) was amplified by PCR from HeLa genomic DNA using the following primers: TUBB3 F 5′ CCACTAGTCGACGAGGAGGAGT 3′ and TUBB3 R 5′ CTCAAGCTTGCCTGGAGCTGCA 3′. The fragment was cloned into the 3′ UTR of a firefly luciferase reporter vector (pMIR-REPORT, Ambion) using HindIII and SpeI. To generate the TUBB 3′UTR containing a mutation in the miR-200c binding site, the following primers were used (mutation in bold): TUBB3mutF 5′-CCTGCATCTTTTATGGCCTCG-3′ and TUBB3mutR 5′-CATAAAAGATGCAGGAGGGCGGCAAGG-3′. Two PCR products were generated using the primer pairs of TUBB3F with TUBB3mutR and TUBB3R with TUBB3mutF. These two PCR products were annealed and used as template for a final PCR reaction generated using the TUBB3F and TUBB3R primers. This generated the final product containing the mutated site, which was cloned into pMIR-Report. Hec50 cells (15,000 cells/well) in a 96 well plate were transfected with the negative control or pre-200c as described above. After 24 hours, the firefly reporter plasmid (0.196 μg) and a renilla luciferase normalization plasmid pRL-SV40 (0.004 μg) were introduced using Lipofectamine 2000. Cells were harvested 48 hours later for analysis using the Dual Luciferase Reporter assay system (Promega).
Results
Low miR-200c Expression Strongly Correlates with Lack of E-cadherin Expression and Gain of Mesenchymal Markers Including ZEB1
We sought to determine if there is a negative correlation between miR-200c and ZEB1 in a panel of endometrial cancer cell lines. Hec50 and AN3CA cells, derived from a serous papillary uterine cancer and a grade-3 endometrioid adenocarcinoma respectively, are highly aggressive and are good models of the behavior of Type 2 endometrial cancers (19). In contrast, Ishikawa cells are derived from a well differentiated, less aggressive, Type 1 endometrial cancer. EEC B37, a cell line derived from normal endometrial epithelial cells (20), and HIESC, derived from normal endometrial stromal cells (21), were also examined. The miR-200c levels were extremely low in the poorly differentiated Type 2 endometrial cell lines and the stromal cell line (Fig. 1A). In comparison, the normal endometrial epithelial cell line and the Ishikawa cells had greater than 150 fold higher miR-200c levels. These results suggest that loss of miR-200c expression is associated with poorly differentiated endometrial carcinoma. Stromal cells also express low levels of miR-200c, consistent with our observation that ZEB1 is expressed in normal endometrial stroma (1, 2). Immunoblot results reveal that ZEB1 protein is present in the Type 2 cell lines (AN3CA and Hec50) as well as normal stromal cells, but normal epithelial cells and the well-differentiated, Ishikawa cancer cells lack ZEB1. Since ZEB1 is a potent repressor of E-cadherin, E-cadherin protein is present only in the normal epithelial cells and Ishikawa cells which express miR-200c robustly and lack ZEB1. More aggressive endometrial cancers often undergo EMT and begin to express stromal markers (1, 2). The normal stromal cells and the more aggressive cancer cell lines, Hec50 and AN3CA, all express vimentin. The former two also express N-cadherin. In contrast, neither the normal epithelial cells nor the Ishikawa cells express vimentin and the normal cells lack expression of N-cadherin. We observe a similar negative correlation between miR-200c and ZEB1 expression, and positive correlation between miR-200c and E-cadherin in a panel of breast (Fig. 1B) and ovarian (Fig. 1C) cancer cells.
Figure 1.
MiR-200c and ZEB1 are inversely correlated in endometrial, breast, and ovarian cancer cells. A, RNA and protein were harvested from endometrial cancer cell lines - AN3CA and Hec50 (high-grade, representing Type II endometrial cancers), and Ishikawa (representing Type I endometrial cancer), EEC B37 (hTERT transformed normal endometrial epithelial cells) and HIESC (SV40 transformed normal endometrial stromal cells). RNA was assayed for miR-200c by real-time PCR (top panel). Immunoblots of whole cell protein extracts were probed for ZEB1, E-cadherin, N-cadherin, vimentin and α-tubulin as a loading control (bottom panel). B, RNA and protein were harvested from aggressive breast cancer cell lines (BT-549 and MDA 231) as well as the more differentiated cell lines (BT-474, MCF7, T47D and ZR75) for detection of miR-200c and immunoblot analysis of epithelial and mesencymal markers. C, Ovarian cell lines (2008, Hey, SKOV3, OVCA 420 and OVCA 433) were harvested and assayed as above. Each graph is representative of 3 independent experiments. For real-time RT-PCR, each bar represents the mean of quadruplicate samples and error bars represent standard error of the mean. MiR-200c levels are normalized to ribosomal RNA and are relative to AN3CA, MDA-MB-231, or 2008 cells respectively.
Restoration of miR-200c Restores E-cadherin Expression and Reduces Migration and Invasion
To determine if miR-200c controls ZEB1 expression in endometrial cancer cells, we used a commercially available miR-200c mimic (pre-200c) to restore miR-200c to Hec50 cells. A time course measuring miR-200c following transfection with the mimic demonstrated maximum levels of expression achieved by 24 hours, gradually decreasing over 6 days, while still remaining above control level (data not shown). At 48 hours post transfection, we achieved a 112-fold expression of miR-200c over mock transfected and scrambled control containing cells (Fig. 2A, top panel). Importantly, at the concentration used for transient transfections, the levels of miR-200c achieved are comparable to the endogenous miR-200c levels found in the well-differentiated Ishikawa cells (Fig. 1A). Increasing miR-200c causes inhibition of ZEB1 expression and importantly, a complete restoration of E-cadherin protein expression (Fig. 2A, bottom panel). To ensure that these effects weren’t cell-type specific, we also performed a transient transfection of pre-200c into MDA-MB-231 cells, an aggressive breast cancer cell line (Fig. 2B). As seen in Fig. 2A and B (bottom panels), restoration of miR-200c to the MDA-MB-231 cells also causes an almost complete repression of ZEB1 levels, resulting in a dramatic appearance of E-cadherin expression. Dual fluorescence immunocytochemistry performed on coverslips from the Hec50 transfection experiment demonstrate that while no E-cadherin (green) is observed in the negative control and mock transfected cells, there is a low level of E-cadherin expression in the majority of the pre-200c treated cells and very high expression in some areas (Fig. 2C), as would be expected in a transient transfection. There is a decrease in nuclear ZEB1 staining (red, pink when overlaid with DAPI) in the pre-200c treated cells. Some apparent ZEB1 staining occurs in the cytoplasm in all treatment groups; however, this is likely non-specific as it is also observed in the isotype antibody control.
Figure 2.
Addition of exogenous miR-200c results in repression of ZEB1 and restoration of E-cadherin protein. Hec50 endometrial cancer cells (A) and MDA-MB-231 breast cancer cells (B) were treated with transfection reagent only (mock), scrambled negative control mimic (negative), or miR-200c mimic (pre-200c). After 48 hours, RNA was harvested and miR-200c levels were determined by real-time PCR as shown in the top panels. Means of quadruplicate samples are shown, with error bars representing standard error of the mean. The miR-200c levels are normalized to ribosomal RNA and are relative to mock transfection levels. Western blots of protein from the three experimental groups (mock, negative, or miR-200c treated) were probed for ZEB1, E-cadherin and α-tubulin as a loading control. Three replicates per treatment group are shown. For both real-time RT-PCR and western blots, results are representative of one of three independent experiments. C, Hec50 cells grown on cover slips were treated as above and fluorescent immunocytochemistry results using antibodies recognizing ZEB1 (red), E-cadherin (green) and DAPI (blue) are shown merged. The bottom panels show relevant IgG negative controls. Magnification 1000X.
To determine if introducing miR-200c renders Hec50 cells less migratory, a wound healing assay was performed on the pre-200c treated cells as well as the negative controls. Fig. 3A demonstrates that Hec50 cells treated with pre-200c are distinctively less migratory than the negative control and mock transfected cells. Furthermore, a trans-well migration assay demonstrated a similar loss of migratory capacity (Fig. 3B). An 82% and 89% decrease in the number of migrating cells was observed in the pre-200c treated cells compared to the mock transfected or negative control treated cells respectively. In addition, 81% fewer pre-200c treated cells were able to invade through matrigel in a trans-well invasion assay as compared to negative control treated cells (Fig. 3C). MiR-200c did not affect the amount of proliferation of the cells as measured with MTT and Hoechst dye assays (data not shown).
Figure 3.
Restoration of miR-200c expression in Hec50 decreases migration and invasion. A, Hec50 cells were treated with transfection reagent only, a scramble negative control or miR-200c mimic. After 48 hours, wounds were inflicted and pictures taken at 0, 4, 8, 12 and 24 hours post wounding. Lines indicate width of the wound at time zero. Pictures shown are from one experiment representative of three separate experiments (not shown). B, Mock, negative, or miR-200c transfected cells were subjected to a transwell migration assay. After 48 hours, cells on the bottom side of the membrane were stained and mounted onto slides and mean number of cells in four fields of vision on a cross-hatch were counted with error bars representing standard error of the mean of four replicates. Asterisk indicates a statistically significant difference between the numbers of cells migrating in the pre-200c, compared to either mock transfected cells or negative control treated cells (p-values of 2.8 × 10−4 and 6.0 × 10−8 respectively, Student’s t-test). Representative images (100X magnification) of stained filters are shown. C, Number of cells able to invade through matrigel coated Boyden chambers was also determined for each group. Again mean number of cells for four replicates are shown with error bars representing standard error of the mean and asterisk indicating a statistically significant difference between the pre-200c treated group, compared to either mock transfected cells or negative control treated cells (p-values of 0.0039 and 0.0020 respectively, Student’s t-test).
Restoration of miR-200c Enhances Chemosensitivity to Microtubule-Directed Agents
To determine if restoration of miR-200c and the resulting re-establishment of epithelial characteristics would affect chemosensitivity, paclitaxel- and cisplatin-induced apoptosis were measured in cells treated with pre-200c versus controls. A significant increase in chemosensitivity to paclitaxel (Fig. 4A), but not cisplatin (Fig. 4B) was detected in Hec50 cells transfected with miR-200c. The chemosensitivity to 25 nM paclitaxel was increased by 37% and 45% in the cells treated with pre-200c versus the mock and negative controls respectively. Since paclitaxel and cisplatin have different modes of action, we performed further cell death ELISAs using agents that induce apoptosis via different mechanisms. FasL and TRAIL induce death through TNF-related cell surface receptors in a caspase 8-dependent manner. No increase in chemosensitivity to either TRAIL or FasL was observed with pre-200c treatment (Fig. 4C). Doxorubicin and mitomycin C, like cisplatin, cause DNA damage that result in apoptosis, and neither agent caused an increase in chemosensitivity in conjunction with pre-200c treatment (Fig. 4D). Epothilone B and vincristine both cause apoptosis by stabilization of microtubules in a mechanism similar to that of paclitaxel. As observed with paclitaxel, pre-200c treatment causes substantial and statistically significant increase in chemosensitivity to these two additional microtubule poisons (Fig. 4E).
Figure 4.
MiR-200c alters cell-death in response to microtubule-targeting chemotherapeutic agents specifically. Hec50 cells were treated with transfection reagent only (mock), scrambled negative control (negative), or miR-200c mimic (pre-200c). Twenty four hours post transfection, cells were treated with 0, 5, 10, 15, 20, or 25 nM paclitaxel (A) or 0, 20, 30, 40 or 50 μM cisplatin (B) and 24 hrs after drug treatment apoptosis was assayed using a Cell Death ELISA, with the data presented as percent maximum apoptosis. Error bars represent standard error of the mean of triplicate samples. This experiment was performed twice and representative experiments for each drug are shown. Asterisks indicate a statistically significant difference between pre-200c treated cells and mock or negative controls (p-value < 0.05, Student’s t-test). Hec50 cells treated with pre-200c or negative controls were treated with agents that cause apoptosis via (C) cell surface receptors (TRAIL, 50 ng/ml or FasL, 125 ng/ml), (D) DNA damage (doxorubicin, 1μg/ml or mitomycin C, 6μg/ml), or (E) microtubule poisons (Vincristine, 100 nM or Epothilone B, 100 nM) and Cell Death ELISAs were performed. Shown is the mean of 5 replicates. Error bars represent standard error of the mean. The experiment was repeated on three separate occasions with the same result, and a representative experiment is shown. Asterisks indicate statistically significant difference between pre-200c and both the mock and negative controls (p-value < 0.05, Student’s t-test).
Identification of Direct and Downstream Targets of miR-200c
While it has been previously shown that miR-200c regulates ZEB1 and ZEB2, many other putative miR-200c targets are predicted by bioinformatics based on complementarity, but remained to be validated. To identify miR-200c direct targets or genes downstream of such targets that might be responsible for the reduction in invasiveness and increased sensitivity to microtubule targeting agents, expression profiling was performed on Hec50 cells treated with pre-200c as compared to mock or scrambled control transfected cells. Our profiling study identified a cluster of genes significantly differentially regulated by miR-200c as compared to both controls (mock and scrambled non-targeting miRNA transfected cells) (Fig. 5A). Additional genes significantly different in the pre-200c versus mock transfected cells or negative control treated cells, but not both, are shown in Fig. 5B. As expected, upon addition of miR-200c, E-cadherin (CDH1) was upregulated (on average, 10.8 fold) and ZEB1 downregulated (by 3.1 fold). A complete list of genes significantly affected by miR-200c with fold changes and p-values, is provided in the Supplemental Data Table 1. Further validation of the microarray results is the fact that eighteen putative direct targets of miR-200c, as predicted by bioinformatics using Sanger miRBase, TargetScan and PicTar databases (including ZEB1 and ZEB2) are differentially regulated in the miR-200c treated cells (Fig. 5C) as compared to controls. The vast majority (14 of 18) of the direct targets are downregulated by miR-200c restoration. Many of the genes identified are not predicted miR-200c targets, but are likely downstream of direct targets (as is the case with E-cadherin, being downstream of the direct target, ZEB1). Interestingly, a significant number of genes affected by pre-200c treatment were recognized by Ingenuity Pathway Software as belonging to a network of genes involved in cellular migration, and these genes are shown in the cluster depicted in Fig. 5D.
Figure 5.
Heatmap of genes significantly affected by restoration of miR-200c levels in Hec50 cells as determined by expression profiling. Hec50 cells were treated in triplicate with a mock transfection, negative control or pre-200c and gene expression analysis was performed on Affymetrix HGU133 Plus 2.0 oligonucleotide cDNA expression array chips. A, Genes with a statistically significant (ANOVA), 1.5 fold or greater upregulation (red) or downregulation (green) in the pre-200c treated cells versus both the negative control and the mock transfected cells are shown in a heatmap. Expected alterations in E-cadherin (CDH1) and ZEB1 are highlighted. B, Genes 1.5 fold or greater up- or downregulated in the pre-200c treated cells versus either negative control are shown in a separate heatmap. C, A heatmap of genes from A or B that are bioinformatically predicted to be targets of miR-200c. D, Genes differentially regulated by miR-200c implicated in cell migration as determined by Ingenuity Pathway Analysis. Note that each gene was normalized to its average expression over the 9 chips, such that the intensities center around one and are presented on a scale of −2 to +2 and are thus not indicative of relative fold changes. Fold changes and p-values for these genes are listed in a table as supplemental data.
To validate the array data, we performed real time RT-PCR on CHK2, ARHGDIB, EPHB1, MAL2, LEPR, and ST6GALNAC5 (Fig. 6A) on independent biological samples. These genes represent both predicted direct targets of miR-200c (LEPR, ST6GALNAC5) as well as presumed downstream targets (CHK2, ARHGDIB, EPHB1 and MAL2). We have also confirmed by RT-PCR that TUBB3 is modestly decreased at the RNA level; however, we observe a more dramatic decrease in TUBB3 protein, indicating that miR-200c may also affect translation of TUBB3 (Fig. 7A left). To test whether TUBB3 is a direct target of miR200c, we cloned the predicted target sequence within the TUBB3 gene downstream of luciferase in a reporter vector. Figure 7A (panel on right) demonstrates that the amount of luciferase is only significantly decreased by the presence of the TUBB3 3′UTR target sequence when miR-200c mimic is transfected into Hec50 cells, and not in the presence of negative control mimic or the mock transfected cells. in In addition, when the target region of the TUBB3 3′UTR was mutated at three base pairs that bind the seed sequence of miR-200c (see asterisks in Figure 7A right side), luciferase is no longer reduced, indicating that the miR-200c binding site has been rendered non-functional. Furthermore, in the aggressive ovarian cancer cell line, Hey, TUBB3 protein levels are even more dramatically reduced by miR-200c (Fig. 7B, left) than they are in the Hec50 cells. To assay whether a more pronounced decrease in TUBB3 corresponds with an even greater chemosensitivity to microtubule targeting agents in the Hey cells, we again performed a cell death ELISA with the panel of chemotherapeutic agents. Similar to the Hec50s, there was no substantial increase in chemosensitivity to agents which cause apoptosis through cell surface receptors or via DNA damage; however, there was a dramatic statistically significant increase in cell death in response to microtubule- targeting agents. The most dramatic increase in response was observed with paclitaxel, in which there is an 82–85% increase in chemosensitivity when miR-200c is restored to the cells (Figure 7B bottom right). There was also a 33–35% increase in chemosensitivity to vincristine in the pre-200c treated cells and a 43–50% increase in response to Epothilone B. Interestingly, MDA-MB-231 cells have been reported to be resistant to taxol by a different method (a mutation in class I beta-tubulin (22)), and we observe that miR-200c does not restore chemosensitivity to microtubule targeting agents in this cell line (data not shown).
Figure 6.
Select genes altered by restoration of miR-200c are validated by RT-PCR. SYBR green real time RT-PCR was performed on Hec50 cells treated with transfection reagent only (mock), 60 nM of a scramble negative control (negative), or 60 nM of the miR-200c mimic (pre-200c) using primers specific for CHK2, ARHGDIB, EPHB1, MAL2, LEPR and ST6GALNAC5. Error bars represent the standard error of the mean of three replicates.
Figure 7.
A site in the TUBB3 3′ UTR is a direct target of miR-200c and a decrease in TUBB3 protein corresponds with an increase in cell death in response to microtubule- targeting agents. A, SYBR green real time RT-PCR using primers specific for TUBB3 was performed on RNA from Hec50 cells treated with pre-miR-200c mimic (pre-200c), negative scrambled control (negative) or mock transfected (mock) control (top left). A corresponding western blot consisting of protein from the same cells was probed for TUBB3 (bottom left) and PSTAIR (used as a loading control). A fragment of the TUBB3 3′UTR (located 117–379 base pairs after the stop codon) containing the putative miR-200c binding site, or the same fragment with the indicated base pairs that bind to the miR-200c seed sequence mutated, were cloned into pMIR-REPORT, luciferase reporter vector. These constructs, empty pMIR-Report vector, vector containing wild-type TUBB3 3′ UTR, or mutated TUBB3 3′UTR (TUBB3 UTR mut), were transfected into Hec50 cells following either transfection with either negative control, pre-200c, or mock transfection. A dual reporter luciferase assay was performed and relative luciferase units (RLU) calculated as firefly luciferase values divided by renilla values. Shown are the mean of five replicate samples and error bars represent standard error of the mean. Single asterisk indicates a P-value of 0.041 for the statistically significant difference in the amount of luciferase detected when the wild-type TUBB3 UTR is in the presence of pre-200c versus negative control. Two asterisks indicates a P-value of 0.006 for the difference in the amount of luciferase in the presence of pre-200c and either the empty vector or wild type TUBB3 3′UTR containing reporter. Three asterisks indicates a P-value of 0.003 for the difference between the amount of luciferase measured when it is targeted by wild-type versus mutated TUBB3 3′UTR. B, An aggressive ovarian cancer cell line, Hey, was treated with pre-200c, a negative control or mock transfection. Western blot for TUBB3 with PSTAIR as a loading control is shown on the top left. A Cell Death ELISA was performed on the mock, negative control, or pre-200c transfected Hey cells treated with various chemotherapeutic agents; top right panel shows Trail and FasL, bottom left panel shows cisplatin, doxorubicin and mitomycin C, and bottom right panel shows paclitaxel, vincristine and epothilone B. Asterisks indicate statistically significant differences (as determined by Student’s t-tests) between the pre-200c treated cells versus negative and mock transfected controls individually (p-values of 5.8 × 10−5 and 7.9 × 10−5 for pre-200c versus mock and negative control respectively in the paclitaxel treated group, p-values of 0.0005 and 0.0009 for pre-200c versus mock and negative control in the vincristine treated group, and p-values of 1.3 × 10−5 and 2.3 × 10−5 pre-200c versus mock and negative control in the epothilone B treated group).
Discussion
In this report we examine the effect of restoring miR-200c expression to poorly differentiated, aggressive endometrial, breast and ovarian cancer cells. Several recent reports have demonstrated the importance of miR-200c, and other miR-200 family members, in the regulation of ZEB1 and ZEB2. Since miRNAs commonly function by binding the 3′ UTRs of genes, the conservation of the target sequences in ZEB1 and ZEB2 emphasizes the importance of miR-200-mediated regulation of these genes. MiR-200c maintains “epithelialness” by suppressing ZEB1 and ZEB2. We show that when we put miR-200c back into aggressive endometrial, breast and ovarian cancer cells that have lost it (restoring it to levels found in normal epithelial cells), we observe dramatic effects on phenotype and behavior. Restoration of miR-200c causes a nearly complete inhibition of ZEB1 expression, and importantly, a very prominent restoration of E-cadherin protein expression. Others have demonstrated that due to their high degree of sequence homology, other miR-200 family members (miR-141 on the same chromosome, 12p13.31, and miR-200b, miR-200a, miR-429 on chromosome 1p36.33) have overlapping functions. However, we show that restoration of miR-200c alone is sufficient to suppress ZEB1 expression, restore E-cadherin, reduce invasive capacity and restore chemosensitivity to microtubule-targeting agents.
Although ZEB1 does repress numerous genes involved in polarity (6, 7), we predicted that such a dramatic reversal of phenotype, invasiveness and chemosensitivity achieved by restoration of miR-200c could not be solely explained by its ability to target ZEB1 and ZEB2. We suspected that just as miR-200c indirectly maintains E-cadherin expression by directly abolishing ZEB1 (a potent E-cadherin repressor), it also likely both directly and indirectly affects other genes involved in polarity, migratory/invasive capacity, and chemosensitivity. Consequently, we performed expression profiling to identify additional genes statistically significantly affected by restoration of miR-200c in Hec50 endometrial cancer cells.
While it is possible that some direct targets of miR-200c might be missed on a cDNA expression array since miRNAs can affect translation of a target messenger RNA without causing a change in transcript levels, microarray expression profiling remains a valid method of identifying global gene changes induced by restoration of miR-200c. Indeed, significant alterations in sixteen genes (in addition to ZEB1 and 2) predicted by bioinformatics to be direct targets of miR-200c were observed with re-introduction of miR-200c to Hec50 endometrial cancer cells. The majority of the predicted target genes (14 of 18) were downregulated by miR-200c in our study. Only 4 (ANKRD1, ANKRD43, ST6GALNAC5, and RAB11FIP1) were upregulated. Although most miRNA targets are downregulated, there is some evidence that miRNAs can target genes for upregulation by at least two different mechanisms (23, 24). Some of the interesting predicted direct targets significantly downregulated by miR-200c in our study include other mesenchymal markers, such as fibronectin 1 (FN1), which, like ZEB1, is marker of EMT and leptin receptor (LEPR), which is overexpressed in breast cancers with poor prognosis and has been implicated in mammary tumorigenesis (25–27). NTRK2 (neurotrophic tyrosine kinase, also known as TrkB) acts as a potent suppressor of anoikis (detachment-induced apoptosis) and is associated with the acquisition of an aggressive tumorigenic and metastatic phenotype in vivo (28). QKI, an RNA binding protein, is involved in myelination and binds to mRNAs encoding oncogenes, suggesting a role for QKI in cancer (29, 30).
Like E-cadherin, some of the other genes identified in our screen are known to be repressed by ZEB1, for instance MAL2, MARVELD2, PKP3, PPL and TACSTD1, have all previously been identified as ZEB1 targets (6, 7) and were significantly increased by miR-200c in our experiments. MAL2, is essential for basolateral-to-apical transcytosis and apical trafficking, a defining feature of epithelial cells. Plakophilin 3 (PKP3) and Periplakin (PPL) are components of desmosomes and MARVELD2 encodes a tight junction protein. TACSTD1 (tumor-associated calcium signal transducer 1, also known as EpCAM) encodes a protein expressed on the apical side of epithelial cells.
We also found that restoration of miR-200c increases ARHGDIB (Rho GDP-dissociation inhibitor beta), an inhibitor of Rho GTPases which acts as a tumor suppressor and is a negative regulator of migration (reviewed in (31)). Thus, in addition to restoring E-cadherin, increasing the tumor suppressor ARHGDIB, is a potential mechanism whereby miR-200c reduces the migratory/invasive behavior of Hec50 cells. Other genes involved in cytoskeleton reorganization, such as WIPF1 (WAS/WASL interacting protein) and EPS8L1 (EPS8-like 1), and CGN (cingulin), which regulates tight junctions, may also be involved in the ability of miR-200c to modulate cell motility. EPHB1 (ephrin receptor B1) is a receptor tyrosine kinase involved in cell-cell interactions, angiogenesis, migration and stem cell polarity (32, 33). In addition, both lysyl oxidase (LOX) and fibronectin 1 (FN1) are significantly decreased by restoration of miR-200c and they are heavily implicated in metastasis and formation of the pre-metastatic niche (34–36).
We also demonstrate that restoration of miR-200c expression renders Hec50 cells more sensitive to paclitaxel and other microtubule directed agents such as vincristine and epothilone B, but not to apoptosis-inducing agents that work through death receptors (TRAIL and FasL) or DNA damaging agents (cisplatin, doxorubicin or mitomycin C). Intriguingly, our microarray data reveal that class III beta-tubulin (TUBB3/TUBB4) gene, a predicted direct target of miR-200c, is significantly downregulated in the presence of miR-200c. This provided an attractive potential mechanism whereby miR-200c restores chemosensitivity specifically to microtubule targeting agents since numerous studies have linked overexpression of TUBB3, normally only expressed in neuronal cells, with resistance to microtubule-targeting agents in many types of cancers (37–40). We confirmed its downregulation in the presence of miR-200c at the RNA level and observed an even more dramatic decrease at the protein level in endometrial and ovarian cancer cells, suggesting that miR-200c may regulate TUBB3 expression primarily through inhibition of TUBB3 translation. Furthermore, we show that the predicted miR-200c target site within theTUBB3 3′UTR is indeed a bona fide target of miR-200c being necessary and sufficient for downregulation of TUBB3 by miR-200c. In Hey ovarian cancer cells, we observed an even more pronounced decrease in TUBB3 protein in response to restoration of miR-200c than observed in Hec50 endometrial cells, and this corresponds with a dramatic 85% increase in chemosensitivity to paclitaxel. The majority of women with advanced ovarian cancer ultimately relapse with drug-resistant disease with an overall 5-year survival of <50%. Several studies have linked expression of TUBB3 with resistance to microtubule-targeting chemotherapeutics in ovarian cancers (41–44). One of these studies (44), examined the three main mechanisms of paclitaxel resistance (overexpression of MDR-1 gene, point mutations in alpha-tubulin and beta-tubulin genes, and selective alterations in the expression of beta-tubulin isotypes) and found that the only statistically significant difference in the resistant subset of tumors was up-regulation of class III beta-tubulin. Thus, we propose that targeting TUBB3 is a major mechanism whereby miR-200c restores chemosensitivity to microtubule targeting agents. We propose that in the clinical setting, restoration of miR-200c could render highly aggressive forms of endometrial and ovarian cancers more responsive to microtubule-targeting chemotherapeutic agents and decrease invasive potential as well.
There is increasing evidence that miRNAs play an important role in many aspects of tumorigenesis and recent reports have implicated the miR-200 family in EMT via direct repression of ZEB1 and ZEB2. Here we extend this developing paradigm by showing that loss of miR-200c is associated with Type 2 endometrial carcinomas as well and that restoration of miR-200c to aggressive endometrial cancer cells results in reestablishment of epithelial identity. E-cadherin and other markers of polarity are re-expressed, cells are rendered substantially less invasive and become significantly more sensitive to microtubule-targeting chemotherapeutic agents. We identify additional genes (other than ZEB1 and 2) directly and indirectly targeted by miR-200c, which are likely responsible for restoration of the epithelial state, decrease in migratory capacity, and increased sensitivity to microtubule-targeting chemotherapeutics. We suggest that loss of miR-200c will be predictive of aggressive behavior and resistance to microtubule-targeting agents, and that restoration of miR-200c has potential as a therapeutic strategy for treating highly metastatic, drug resistant, and thus otherwise relatively untreatable, cancers.
Supplementary Material
Acknowledgments
This work was funded by Career Development Award to JKR (NCI Cancer Center Support Grant #P30-CA046934) from MD Anderson Uterine SPORE CA098258 NIH/NCI, The Avon Foundation, and Department of Pathology start-up funds to JKR. D.C. was supported by a Thorkildsen Research Fund Endowment.
We thank Monique Spillman, MD. Ph.D. and Barb Helfrich, M.S. at the University of Colorado Denver for providing ovarian cancer cell lines. We acknowledge Christopher Korch, Ph.D. in the University of Colorado Cancer Center DNA Sequencing and Analysis Core, supported by the NIH/NCI Cancer Core Support Grant (P30 CA046934).
Abbreviations
- EMT
epithelial to mesenchymal transition
- miRNA
microRNA
- ZEB1
Zinc finger E-box binding homeobox 1
References
- 1.Singh M, Spoelstra NS, Jean A, et al. ZEB1 expression in type I vs type II endometrial cancers: a marker of aggressive disease. Mod Pathol. 2008;21:912–923. doi: 10.1038/modpathol.2008.82. [DOI] [PubMed] [Google Scholar]
- 2.Spoelstra NS, Manning NG, Higashi Y, et al. The transcription factor ZEB1 is aberrantly expressed in aggressive uterine cancers. Cancer Res. 2006;66:3893–3902. doi: 10.1158/0008-5472.CAN-05-2881. [DOI] [PubMed] [Google Scholar]
- 3.Eger A, Aigner K, Sonderegger S, et al. DeltaEF1 is a transcriptional repressor of E-cadherin and regulates epithelial plasticity in breast cancer cells. Oncogene. 2005;24:2375–2385. doi: 10.1038/sj.onc.1208429. [DOI] [PubMed] [Google Scholar]
- 4.Guaita S, Puig I, Franci C, et al. Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem. 2002;277:39209–39216. doi: 10.1074/jbc.M206400200. [DOI] [PubMed] [Google Scholar]
- 5.Ohira T, Gemmill RM, Ferguson K, et al. WNT7a induces E-cadherin in lung cancer cells. Proc Natl Acad Sci U S A. 2003;100:10429–10434. doi: 10.1073/pnas.1734137100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Aigner K, Dampier B, Descovich L, et al. The transcription factor ZEB1 (deltaEF1) promotes tumour cell dedifferentiation by repressing master regulators of epithelial polarity. Oncogene. 2007;26:6979–6988. doi: 10.1038/sj.onc.1210508. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Aigner K, Descovich L, Mikula M, et al. The transcription factor ZEB1 (deltaEF1) represses Plakophilin 3 during human cancer progression. FEBS Lett. 2007;581:1617–1624. doi: 10.1016/j.febslet.2007.03.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Horn LC, Meinel A, Handzel R, Einenkel J. Histopathology of endometrial hyperplasia and endometrial carcinoma: an update. Ann Diagn Pathol. 2007;11:297–311. doi: 10.1016/j.anndiagpath.2007.05.002. [DOI] [PubMed] [Google Scholar]
- 9.Ryan AJ, Susil B, Jobling TW, Oehler MK. Endometrial cancer. Cell Tissue Res. 2005;322:53–61. doi: 10.1007/s00441-005-1109-5. [DOI] [PubMed] [Google Scholar]
- 10.Kurman RJ, Shih Ie M. Pathogenesis of ovarian cancer: lessons from morphology and molecular biology and their clinical implications. Int J Gynecol Pathol. 2008;27:151–160. doi: 10.1097/PGP.0b013e318161e4f5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.McCluggage WG. My approach to and thoughts on the typing of ovarian carcinomas. J Clin Pathol. 2008;61:152–163. doi: 10.1136/jcp.2007.049478. [DOI] [PubMed] [Google Scholar]
- 12.Shih Ie M, Kurman RJ. Ovarian tumorigenesis: a proposed model based on morphological and molecular genetic analysis. Am J Pathol. 2004;164:1511–1518. doi: 10.1016/s0002-9440(10)63708-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zhang W, Dahlberg JE, Tam W. MicroRNAs in tumorigenesis: a primer. Am J Pathol. 2007;171:728–738. doi: 10.2353/ajpath.2007.070070. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kent OA, Mendell JT. A small piece in the cancer puzzle: microRNAs as tumor suppressors and oncogenes. Oncogene. 2006;25:6188–6196. doi: 10.1038/sj.onc.1209913. [DOI] [PubMed] [Google Scholar]
- 15.Calin GA, Liu CG, Sevignani C, et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci U S A. 2004;101:11755–11760. doi: 10.1073/pnas.0404432101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hurteau GJ, Carlson JA, Spivack SD, Brock GJ. Overexpression of the microRNA hsa-miR-200c leads to reduced expression of transcription factor 8 and increased expression of E-cadherin. Cancer Res. 2007;67:7972–7976. doi: 10.1158/0008-5472.CAN-07-1058. [DOI] [PubMed] [Google Scholar]
- 17.Gregory PA, Bert AG, Paterson EL, et al. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 2008;10(5):593–601. doi: 10.1038/ncb1722. [DOI] [PubMed] [Google Scholar]
- 18.Park SM, Gaur AB, Lengyel E, Peter ME. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008;22:894–907. doi: 10.1101/gad.1640608. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Albitar L, Pickett G, Morgan M, Davies S, Leslie KK. Models representing type I and type II human endometrial cancers: Ishikawa H and Hec50co cells. Gynecol Oncol. 2007;106:52–64. doi: 10.1016/j.ygyno.2007.02.033. [DOI] [PubMed] [Google Scholar]
- 20.Kyo S, Nakamura M, Kiyono T, et al. Successful immortalization of endometrial glandular cells with normal structural and functional characteristics. Am J Pathol. 2003;163:2259–2269. doi: 10.1016/S0002-9440(10)63583-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chapdelaine P, Kang J, Boucher-Kovalik S, et al. Decidualization and maintenance of a functional prostaglandin system in human endometrial cell lines following transformation with SV40 large T antigen. Mol Hum Reprod. 2006;12:309–319. doi: 10.1093/molehr/gal034. [DOI] [PubMed] [Google Scholar]
- 22.Wiesen KM, Xia S, Yang CP, Horwitz SB. Wild-type class I beta-tubulin sensitizes Taxol-resistant breast adenocarcinoma cells harboring a beta-tubulin mutation. Cancer Lett. 2007;257:227–235. doi: 10.1016/j.canlet.2007.07.022. [DOI] [PubMed] [Google Scholar]
- 23.Pillai RS, Bhattacharyya SN, Artus CG, et al. Inhibition of translational initiation by Let-7 MicroRNA in human cells. Science. 2005;309:1573–1576. doi: 10.1126/science.1115079. [DOI] [PubMed] [Google Scholar]
- 24.Place RF, Li LC, Pookot D, Noonan EJ, Dahiya R. MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc Natl Acad Sci U S A. 2008;105:1608–1613. doi: 10.1073/pnas.0707594105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Cleary MP, Juneja SC, Phillips FC, et al. Leptin receptor-deficient MMTV-TGF-alpha/Lepr(db)Lepr(db) female mice do not develop oncogene-induced mammary tumors. Exp Biol Med (Maywood) 2004;229:182–193. doi: 10.1177/153537020422900207. [DOI] [PubMed] [Google Scholar]
- 26.Garofalo C, Koda M, Cascio S, et al. Increased expression of leptin and the leptin receptor as a marker of breast cancer progression: possible role of obesity-related stimuli. Clin Cancer Res. 2006;12:1447–1453. doi: 10.1158/1078-0432.CCR-05-1913. [DOI] [PubMed] [Google Scholar]
- 27.Miyoshi Y, Funahashi T, Tanaka S, et al. High expression of leptin receptor mRNA in breast cancer tissue predicts poor prognosis for patients with high, but not low, serum leptin levels. Int J Cancer. 2006;118:1414–1419. doi: 10.1002/ijc.21543. [DOI] [PubMed] [Google Scholar]
- 28.Geiger TR, Peeper DS. Critical role for TrkB kinase function in anoikis suppression, tumorigenesis, and metastasis. Cancer Res. 2007;67:6221–6229. doi: 10.1158/0008-5472.CAN-07-0121. [DOI] [PubMed] [Google Scholar]
- 29.Chenard CA, Richard S. New implications for the QUAKING RNA binding protein in human disease. J Neurosci Res. 2008;86:233–242. doi: 10.1002/jnr.21485. [DOI] [PubMed] [Google Scholar]
- 30.Galarneau A, Richard S. Target RNA motif and target mRNAs of the Quaking STAR protein. Nat Struct Mol Biol. 2005;12:691–698. doi: 10.1038/nsmb963. [DOI] [PubMed] [Google Scholar]
- 31.Harding MA, Theodorescu D. RhoGDI2: a new metastasis suppressor gene: discovery and clinical translation. Urol Oncol. 2007;25:401–406. doi: 10.1016/j.urolonc.2007.05.006. [DOI] [PubMed] [Google Scholar]
- 32.Conover JC, Doetsch F, Garcia-Verdugo JM, et al. Disruption of Eph/ephrin signaling affects migration and proliferation in the adult subventricular zone. Nat Neurosci. 2000;3:1091–1097. doi: 10.1038/80606. [DOI] [PubMed] [Google Scholar]
- 33.Chumley MJ, Catchpole T, Silvany RE, Kernie SG, Henkemeyer M. EphB receptors regulate stem/progenitor cell proliferation, migration, and polarity during hippocampal neurogenesis. J Neurosci. 2007;27:13481–13490. doi: 10.1523/JNEUROSCI.4158-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Erler JT, Bennewith KL, Nicolau M, et al. Lysyl oxidase is essential for hypoxia-induced metastasis. Nature. 2006;440:1222–1226. doi: 10.1038/nature04695. [DOI] [PubMed] [Google Scholar]
- 35.Erler JT, Giaccia AJ. Lysyl oxidase mediates hypoxic control of metastasis. Cancer Res. 2006;66:10238–10241. doi: 10.1158/0008-5472.CAN-06-3197. [DOI] [PubMed] [Google Scholar]
- 36.Psaila B, Kaplan RN, Port ER, Lyden D. Priming the ‘soil’ for breast cancer metastasis: the pre-metastatic niche. Breast Dis. 2006;26:65–74. doi: 10.3233/bd-2007-26106. [DOI] [PubMed] [Google Scholar]
- 37.Pusztai L. Markers predicting clinical benefit in breast cancer from microtubule-targeting agents. Ann Oncol. 2007;18(Suppl 12):xii15–20. doi: 10.1093/annonc/mdm534. [DOI] [PubMed] [Google Scholar]
- 38.Seve P, Dumontet C. Is class III beta-tubulin a predictive factor in patients receiving tubulin-binding agents? Lancet Oncol. 2008;9:168–175. doi: 10.1016/S1470-2045(08)70029-9. [DOI] [PubMed] [Google Scholar]
- 49.Paradiso A, Mangia A, Chiriatti A, et al. Biomarkers predictive for clinical efficacy of taxol-based chemotherapy in advanced breast cancer. Ann Oncol. 2005;16(Suppl 4):iv14–19. doi: 10.1093/annonc/mdi902. [DOI] [PubMed] [Google Scholar]
- 40.Tommasi S, Mangia A, Lacalamita R, et al. Cytoskeleton and paclitaxel sensitivity in breast cancer: the role of beta-tubulins. Int J Cancer. 2007;120:2078–2085. doi: 10.1002/ijc.22557. [DOI] [PubMed] [Google Scholar]
- 41.Kavallaris M, Annereau JP, Barret JM. Potential mechanisms of resistance to microtubule inhibitors. Semin Oncol. 2008;35:S22–27. doi: 10.1053/j.seminoncol.2008.01.006. [DOI] [PubMed] [Google Scholar]
- 42.Kavallaris M, Kuo DY, Burkhart CA, et al. Taxol-resistant epithelial ovarian tumors are associated with altered expression of specific beta-tubulin isotypes. J Clin Invest. 1997;100:1282–1293. doi: 10.1172/JCI119642. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Mozzetti S, Ferlini C, Concolino P, et al. Class III beta-tubulin overexpression is a prominent mechanism of paclitaxel resistance in ovarian cancer patients. Clin Cancer Res. 2005;11:298–305. [PubMed] [Google Scholar]
- 44.Umezu T, Shibata K, Kajiyama H, et al. Taxol resistance among the different histological subtypes of ovarian cancer may be associated with the expression of class III beta-tubulin. Int J Gynecol Pathol. 2008;27:207–212. doi: 10.1097/PGP.0b013e318156c838. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








