TABLE 1.
BACs, plasmids, primers, and strains used in this study
| Reagent | Description or purpose | Source, reference, or sequencea |
|---|---|---|
| BACs | ||
| VZVLUC | VZV pOKA with firefly luciferase and GFP | 40 |
| Δ30L | galK cassette replaced ORF30 bp 144–2063 in VZVLUC | This study |
| Δ30M | galK cassette replaced ORF30 bp 144–1782 in VZVLUC | This study |
| Δ30S | galK cassette replaced ORF30 bp 1080–1260 in VZVLUC | This study |
| 30R | Wild-type ORF30 replaced galK cassette in Δ30L BAC | This study |
| 30-620A | H-to-A mutation at ORF30 aa 620 | This study |
| 30-622A | K-to-A mutation at ORF30 aa 622 | This study |
| 30-IXAla | PHLKEE-to-AAAAAA mutation at ORF30 aa 619–624 | This study |
| 30-ZF3Ab | C-to-A, C-to-A, and H-to-A mutations at ORF30 aa 202, 225, and 227, respectively | This study |
| Plasmid | ||
| pgalK | Used to flank galK cassette with ORF30 homology arms | 44 |
| Bacterial strain | ||
| SW102 | Used to propagate/manipulate VZV BAC clones | 44 |
| Primersc | ||
| Δ30L-galK F | Used to generate ORF30 homology arm from bp 144 | GGGTGGCGTGTCGCTTTTTATATCGGTTAGCGGCTAACTGTTTGACAGTTcctgttgacaattaatcatcggca |
| Δ30L-galK R | Used to generate ORF30 homology arm from bp 2063 | CTTTAGGTTGAGACGTGCACCCGCGTGGATCCTTACCTAGACGGTCAACGtcagcactgtcctgctcctt |
| Δ30M-galK R | Used to generate ORF30 homology arm from bp 1782 | GTAAAAAATAAGGCGGTGTTAGGGGGTTGTGCAAAACGGTGTTCATCGTGtcagcactgtcctgctcctt |
| Δ30S-galK F | Used to generate ORF30 homology arm from bp 1080 | CACGCAGAACTTACAGCCGTAACGGTTGAGTTGGCGTTATTTGGAAAAACTcctgttgacaattaatcatcggca |
| Δ30S-galK R | Used to generate ORF30 homology arm from bp 1260 | TCATCCTCACACCCAACTCTTTCTAAAAGTTGGCGTAAGGCGGCTTCGTTtcagcactgtcctgctcctt |
| 30R F | Used to repair Δ30L and to make Ala mutations | ATGGAATTGGATATTAATCGAAC |
| 30R R | Used to repair Δ30L and to make Ala mutations | TTATGAAAACGCCGGGTCCGTTGAA |
| Δ30-620 F | Used with 30R R to generate H-to-A mutation at ORF30 aa 620 | CCGgcCTTAAAAGAGGAATTGGCAAAGTTTATG |
| Δ30-620 R | Used with 30R F to generate H-to-A mutation at ORF30 aa 620 | TTCCTCTTTTAAGgcCGGAAATAGGCCAACGTT |
| Δ30-622 F | Used with 30R R to generate K-to-A mutation at ORF30 aa 622 | CCGCACTTAgcAGAGGAATTGGCAAAGTTTATG |
| Δ30-622 R | Used with 30R F to generate K-to-A mutation at ORF30 aa 622 | TTCCTCTgcTAAGTGCGGAAATAGGCCAACGTT |
| Δ30-ALA F | Used with 30R R to generate ORF30 Ala substitutions at aa 619–624 | gctgccgcagcggctgccTTGGCAAAGTTTATG |
| Δ30-ALA R | Used with 30R F to generate ORF30 Ala substitutions at aa 619–624 | ggcagccgctgcggcagcAAATAGGCCAACGTT |
| 30-ZF F | Used with 30R R to generate C-to-A mutation at ORF30 aa 225 and H-to-A mutation at ORF30 aa 227 | AACCAAGGTGAGACCTTACATCGTAGATTATTAGGATGTATCgcCGATgcCGTTACT |
| 30-ZF Rb | Used with 30R F to generate C-to-A mutation at ORF30 aa 199 and C-to-A mutation at ORF30 aa 202 | GGTCTCACCTTGGTTAGCTGTTATACATAATTCTTCAAAAgcTATAGCAgcTGGATG |
| ARPE30 F | Used to validate ORF30 genomic integration | ATGGAATTGGATATTAATCG |
| ARPE30 R | Used to validate ORF30 genomic integration | TTATGAAAACGCCGGGTCCG |
| ORF29-3′ F | Used to identify genotypes present in complementation plaques | TTGCGTGTAGTCCTTACCCAT |
| ORF31-5′ R | Used to identify genotypes present in complementation plaques | GCTTGGAGAGACCGACACAA |
a
VZV sequences are shown in uppercase, VZV mutations in lowercase bold type, and galK sequences in lowercase lightface type.
b
30-ZF3A contains only 3 of the 4 targeted substitutions. The C-to-A substitution at position 199 was not observed in the sequence of the homology arm or the final BAC construct.
c
Primers are forward (F) or reverse (R) with respect to the genome map.