. 2015 Sep 24;10(9):e0138699. doi: 10.1371/journal.pone.0138699

Table 1. Primers for characterization of variable tandem repeats in four loci of the genome of 'Ca. Liberibacter asiaticus' strains.

Motif	Sequence	Genome position	Primers' seqoence 5'-3'	Reference	Amplicon size(bp)
001	`TACAGGA`	255591–255646	(+)`ggtgaattaggatggaaatgc`	[21]	1159
			(-)`tgaagtagctctgcaatatctga`
			(-)`tgcctcttctagggcacaa`	this paper	The primer was used for only sequence.
002	`CAGT`	537729–537760	(+)`ttgataatatagaaagaggcgaagc`	[21]	510
			(-)`tccatacccaaaagaaaagca`
005	`AGACACA`	354493–354527	(+)`attgaaggacgaaaccgatg`	[21]	598
			(-)`tcccaaggttttcaaattgc`
077	`TTTG`	655277–655332	(+)`tgactgatggcaaaagatgg`	[21]	528
			(-)`agacacgccaaacaaggaat`