Skip to main content
. 2015 Jul 24;7(3):144–154. doi: 10.1038/ijos.2015.18

Table 1. Splinkerette PCR analysis results indicating PB-mediated integration sites in the human genome.

No. Sequence corresponding to the endogenous porcine genome (5′–3′) Known sequences showing similarity (>80%) to the endogenous porcine genome
1 TTAATAGTCATTCTCTTAGTCCTTTAAGCAACATGG Mus musculus chromosome 1, clone RP23-23I4, complete sequence
    Sequence ID: gb|AC131577.16|
2 TTAATAGTCATTCTCTTAGTCCTTTAAGCAACATGG Sus scrofa 5 BAC CH230-4L11, clone RP23-23I4, complete sequence
    Sequence ID: gb|AC094527.7|