Table 4.
Structure of the table ‘misa_ssr_primer’ that stores the primer information of microsatellites of mitochondrial and chloroplast genomes detected by MISA
| Information | Field | Data Type | Key | Example |
|---|---|---|---|---|
| Accession number | acc_no | int(11) | PRI | 5881414, 110189662 |
| Motif with iteration count | SSR | varchar(255) | (AT)4 | |
| Type of repeat | SSR_type | varchar(5) | p1, (mono), p2 (di), p3 (tri) etc, c and c* (compound) | |
| Size | int(4) | int(4) | 31, 20 | |
| Starting co-ordinate of SSR | SSR_start | int(7) | PRI | 172, 12843 |
| Ending co-ordinate of SSR | SSR_end | int(7) | PRI | 182, 12885 |
| Forward primer 1 | FORWARD_PRIMER_1 | varchar(30) | AAAAAGGCCCCTTCCCCC | |
| Melting temperature for forward primer 1 | Tm_F_1 | varchar(6) | 59.463 | |
| Size of forward primer 1 | size_F_1 | int(6) | 18 | |
| Reverse primer 1 | REVERSE_PRIMER_1 | varchar(30) | GCGCCTAAGGATCCTGTGAG | |
| Melting temperature for reverse primer 1 | Tm_R_1 | varchar(6) | 60.25 | |
| Size of reverse primer 1 | size_R_1 | int(6) | 20 | |
| Product size (in bp) | PRODUCT_size_bp_1 | 220 | ||
| Starting co-ordinate of primer 1 | start_bp_1 | 6256 | ||
| Ending co-ordinate of primer 1 | end_bp_1 | 6475 |
The last nine columns of the table will be repeated for reverse primer 1, forward primer 2, reverse primer 2, forward primer 3 and backward primer 3.