Skip to main content
. 2015 Sep 9;112(38):E5343–E5350. doi: 10.1073/pnas.1506468112

Table S2.

Details of primers used, their source, annealing temperature, and expected amplicon size

Target Name Sequence (5′–3′) Reference or source Annealing Amplicon size, bp
E. tenella TEN-F TCGTCTTTGGCTGGCTATTC Vrba et al., 2010 (63) 56 °C 100
 gDNA, diagnostic TEN-R CAGAGAGTCGCCGTCACAGT Vrba et al., 2010 (63)
Eimeria 5S rRNA 5S_For TCATCACCCAAAGGGATT Blake et al., 2006 (64) 56 °C ∼110
5S_Rev TTCATACTGCGTCTAATGCAC Blake et al., 2006 (64)
E. tenella AMA-1 EtAMA1_fl_F CACCATGCGGCGGCTTTC This study 60 °C 1,610*
 cDNA EtAMA1_fl_R CCTGGTCCAGCAGCACTTGG This study
*

Amplicon size calculated using cDNA as template.