Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Primer | Sequence (5’-3’) | Genomic co-ordinates (GRCh38/hg38) |
|---|---|---|
| Forward | GGGGGTTGGGGGATATAAA | chr13:91348926–91348944 |
| Reverse (biotinylated) | CCTTTTTCAATTCCTTTTCCCTTTAC | chr13:91349234–91349209 |
| Sequencing | GGGGGATATAAAGGAG | chr13:91348933–91348948 |
