Skip to main content
. 2014 Sep 28;6(3):258–264. doi: 10.4161/21505594.2014.967608

Table 2.

Sequence and formamide concentrations for FISH Probes

Organism Name FA1 WB2 Sequence (5′ → 3′) Source
A. actinomyc. Aact639 40% 46 mM CTCCAGACCCCCAGTATG This study
E. faecalis Efae470 30% 112 mM GATACCGTCAGGGGACGTTC 43
S. aureus Saur229 40% 46 mM CTAATGCAGCGCGGATCC This study
E. coli EBAC1790 30% 112 mM CGTGTTTGCACAGTGCTG 44
1

Formamide concentration in the hybridization buffer.

2

Concentration of NaCl used in the washing buffer.