Table 2. Primers and Universal Probe Library identities used for the amplification of two housekeeping genes (StNuclear and St40S) and six target genes (StHB20, StOsmotin2, StSAUR2, StJas, StmRNA, StLEDI).
| Name | Accession | UPL probe | Left primer | Right primer |
|---|---|---|---|---|
| StNuclear | DMG400023981 | #114 | tggtgacaattgaagcgttg | tggggcataaacaaagatcc |
| St40S | DMG400020803 | #69 | gccactggtggcaagaag | ctggcggccaagttcata |
| StHB20 | DMG400000248 | #143 | gctgcttcagcagtctgtca | acctcctcgcgttgttattg |
| StOsmotin2 | DMG400003057 | #10 | ctgcccctacaccgtttg | caccaactctgacctctctcg |
| StSAUR2 | DMG400016561 | #150 | cacaaagcattgctcctatcaa | tgttggtttccactttcttgg |
| StJas | DMG400002930 | #145 | ctcaacaaacagctaccaccac | cgatgaatcacttgatttctcaat |
| StmRNA | DMG402007388 | #133 | aaaatatggtcaaaaagtgacaagag | catgttggtgcaaatgaacac |
| StLEDI | DMG402018777 | #122 | ggatgaaaacagttggggtaaa | ccttcctcatgggtacaagg |
StNuclear is annotated in potato as a small nuclear ribonucleoprotein G and the closest homolog in A. thaliana is AT2G23930.1 with the same annotation. ST40S, annotated as a 40 S ribosomal protein S8 in potato, has similarity to A. thaliana AT5G59240.1, also a ribosomal protein S8e family protein. The closes A. thaliana homolog to potato StHB20, a homedomain 20 transcription factor, is AT3G61890.1 encoding for homeobox 12. StOsmotin2 has been annotated as Osmotin OSML15 in potato and the highest sequence identity in A. thaliana is to AT4G11650.1, annotated as osmotin 34. StSAUR2, an auxin-induced SAUR, shows homology to A. thaliana gene AT1G29510.1, a SAUR-like auxin-responsive protein. StJas, annotated as jasmonate ZIM-domain protein 1 in potato, displays homology to AT1G19180.1 with the same annotation. StmRNA is a 1346 bp sequence with no further annotation in potato with the highest sequence similarity to A. thaliana AT1G80840.1, a WRKY DNA-binding protein 40. StLEDI is annotated as LEDI-5c with the highest sequence similarity to AT1G76690.1, encoding for 2-oxophytodienoate reductase 2.