Table 2.
Characterisation of the PARK2 gene rearrangements identified among PD patients
| ID | Rearrangement characterisation | Repetitive elements within breakpoint regions (5′/3′) | ||
|---|---|---|---|---|
| MLPA | aCGH Size of del/dup a,bRearrangements description according to ISCN 2013 |
Breakpoint coordinates Size of del/dup cRearrangements description according to HGVS v2 |
||
| PARK2 deletions | ||||
| 1 | Ex3del |
16,904 bp arr[hg18] 6q26g.(162,620,085-162,603,181)x1 pat |
17,390 bp Chr6(NCBI36):g.162,620,515_162,603,125del |
LINE-1/Unique |
| 2 | Ex4_7del |
483,375 bp arr[hg18] 6q26g.(162,546,840-162,063,483)x1 |
483,785 bp Chr6(NCBI36):g.162,547,004_162,063,219del |
Unique/Unique |
| 3* | Ex3_7del |
164,683 bp (Ex3del) arr[hg18] 6q26g.(162,734,637-162,569,954)x1 pat/483,357 bp (Ex4_7del) arr[hg18] 6q26g.(162,546,840-162,063,483)x1 mat |
165,563 bp Chr6(NCBI36):g.162,735,128_162,569,565delAATGTAATGTTTGTTTAATACGTAAins/483,785 bp Chr6(NCBI36):g.162,547,004_162,063,219del |
Unique/Unique Unique/Unique |
| 4* | Ex3_4del |
176,434 bp arr[hg18] 6q26g.(162,691,028-162,514,594)x1 pat |
176,803 bp Chr6(NCBI36):g.162,691,457_162,514,654del |
LINE-1/Unique |
| 5 | Ex6_7del |
317,108 bp arr[hg18] 6q26g.(162,382,338-162,065,230)x1 |
317,810 bp Chr6(NCBI36):g.162,382,573_162,064,763del |
Unique/Unique |
| PARK2 duplications | ||||
| 6* | Ex2_5dup |
647,223 bp arr[hg18] 6q26g.(163,009,828-162,362,605)x3 pat |
646,341 bp Chr6(NCBI36):g.162,362,806_163,009,147dupinvAAGATTTinsd |
SINE/Alu/Unique |
| 7 | Ex2dup |
115,911 bp arr[hg18] 6q26g.(162,824,231-162,708,320)x3 |
116,072 bp Chr6(NCBI36):g.162,824,128_162,708,056dup |
Unique/LTR/ERVL-MaLR |
| 8* | Ex2dup |
199,391 bp arr[hg18] 6q26g.(162,835,867-162,636,476)x3 |
198,650 bp Chr6(NCBI36):g.162,835,997_162,637,347dupTins |
Unique/Unique |
*Clinical data and partial genetic data already published in Koziorowski et al. (2010, 2013)
aGenomic coordinates according to the distal internal deletion/duplication probes NimbleGen CGH 385K chromosome 6 tiling v2.0D array; NCBI36/hg18 assembly
bISCN 2013 nomenclature, Simons et al. (2013)
cHGVS v2 nomenclature, den Dunnen and Antonarakis (2000)
dGenomic coordinates according to (+) strand