Skip to main content
. 2015 Oct 15;16(10):24555–24573. doi: 10.3390/ijms161024555

Table 7.

Oligonucleotides primers used in this study for quantitative real-time-PCR analysis. The primer sequences were designed by using the ProbeFinder Version 2.50 (http://www.roche-applied-science.com).

Accession No. Symbol Primer Sequence
NM_053429 Fgfr3 Forward acgccctacgtcactgtactc
Reverse gaacctctagctccctgtcg
NM_031550 Cdkn2a Forward cagattcgaactgcgagga
Reverse tgcagtactaccagagtgtctagga
NM_001106243 Map4k1 Forward cgcctgtctttcattggaac
Reverse cacctttcagggccacag
NM_019294 Cacna1e Forward taccgcgcctggatagac
Reverse gctgatgttcccgagttttt
NM_024351 Hspa8 Forward gcacaggaaaggagaacaagat
Reverse catgcgctcaatatcctcct
NM_001008847 RT1-Da Forward aacgcaacgcagtggaac
Reverse tcaatgagctctcacggaag
NM_013141 Ppard Forward ggaccagagcacacccttc
Reverse gaggaaggggaggaattctg
NM_001014096 Cldn18 Forward gtgccggccatacttcac
Reverse atgcccacgatcatcagg
XM_001073458 Tcf7 Forward tcccccatactgtgagctg
Reverse ggcagggaagtgctgtctat
EF156276 β-actin Forward cccgcgagtacaaccttct
Reverse cgtcatccatggcgaact