Table 1.

Sequences of real-time PCR primers and amplification reactions conditions

Gene	Primers 5' 3'	Amplicon length (bp)	Amplification condition
GAPDH	F:CAAGATGGTGAAGGTCGGTGTG R:CGTGGGTAGAGTCATACTGGAA	158	15 min at 94 °C, 40 cycles of 94 °C 10 s, 60 °C 15 s, and 72°C 30 s
MC4R	F:GACGGAGGATGCTATGAG R:AGGTTCTTGTTCTTGGCTAT	116	15 min at 94 °C, 40 cycles of 94 °C 10 s, 56.6 °C 15 s, and 72°C 30 s
Beta-actin	F:CCACACTTTCTACAATGAGC R:ATACAGGGACAACACAGC	169	15 min at 94 °C, 40 cycles of 94 °C 15 s, 57.8 °C 20 s, and 72°C 30 s

F: forward; R: Reverse