Skip to main content
. 2015 Nov 13;81(24):8339–8345. doi: 10.1128/AEM.02752-15

TABLE 2.

List of primers and probes used in this study

Primer or probe Sequence (5′ to 3′)a Purposeb Reference or source
RHO1inlATqMnF CGG ATG CAG GAG AAA ATC CTA TAC Amplification of a 134-bp fragment of the 5′ region of inlA This study
RHO2inlATqMnR CGC TGC CAA ATA CTA ATA TTG CTA CTA G Amplification of a 134-bp fragment of the 5′ region of inlA This study
inlA proF TTT TAA AAG GTG GAA TGA CA Sequencing primer for entire inlA ORF 24
inlA proR GAA GCG TTG TAA CTT GGT CTA Sequencing primer for entire inlA ORF 24
inlA F1 CAG GCA GCT ACA ATT ACA CA Sequencing primer for entire inlA ORF 24
inlA S1R GGA CTG ATG TTA CTT ATT TGG T Sequencing primer for entire inlA ORF 24
inlA F2 AAG ATA TAG GCA CAT TGG CGA GTT Sequencing primer for entire inlA ORF 24
inlA S2R CGT ACT GAA ATY CCA KTT AGT TCC Sequencing primer for entire inlA ORF 24
inlA seq GTG GAC GGC AAA GAA ACA AC Sequencing primer for entire inlA ORF 24
F inlA R ATA TAG TCC GAA AAC CAC ATC T Sequencing primer for entire inlA ORF 24
RHO8-inlA-TqMn-WT TAGTGAGAAAAAAACGATATG (reporter, FAM; quencher, MGB) TaqMan probe for detection of A7 HT This study
RHO9-inlA-TqMn-FS AGTGAGAAAAAACGATATG (reporter, VIC; quencher, MGB) TaqMan probe for detection of A6 HT This study
CSM1-inlA-TqMn-Gtrans ATAGTGAGAAGAAAACGATATG (reporter, NED; quencher, MGB) TaqMan probe for detection of A2GA4 HT This study
a

MGB, minor groove binder; FAM, 6-carboxyfluorescein. VIC and NED are commercially available fluorescent dyes.

b

ORF, open reading frame.