Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for constructs described in this study
| Primer | Sequence (5′-3′)a | Restriction enzyme |
|---|---|---|
| GFPPstI | GCGCTGCAGCTgtgagcaagggcgaggagctg | PstI |
| GFPRTD | GGACGAGCTGTACAAGGGGGACGACGCTCCCCCG | |
| RTDHindIII | GGAAGCTTTTAatctaagggacttctgg | HindIII |
| R4SacIF | ACGGAGCTCGgcgtggtgcgatcagctgctgcagcagatgcagtgctgggcggtgagcaagggcgag | SacI |
| shGFP-R | CCGAAGCTTTTAgccgctttacttgtacagctcg | HindIII |
Lowercase text indicates coding region of the fusion protein. Restriction sites are underlined.
