Table 1. Summary of primers and enrichment oligomers used to amplify prey DNA from Burmese python GI contents.
The blocking primer and PNA clamp overlap with a 7- and 9-bp region, respectively, of the forward mini-barcoding primer.
| Description | Name | Sequence (5′ → 3′) | Tm (°C) | Size (bp) |
|---|---|---|---|---|
| Mini-barcoding primer—Forward | miniBarF | TCAACTAACCACAAAGATATYGGMAC | 55.3 | 26 |
| Mini-barcoding primer—Reverse | miniBarR | GAARATTATTACRAAWGCATGGGC | 53.0 | 24 |
| Blocking primer | coxBlock | TCGGCACATTATACCTACTATTTGGTGC/3Phos/ | 58.4 | 28 |
| PNA clamp | coxPNA | TATCGGCACATTATACCTAC | 74.0 | 20 |