Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Jul 1.
Published in final edited form as: Addict Biol. 2015 Jun 2;21(4):859–872. doi: 10.1111/adb.12276

Role for the satiety factor Oleoylethanolamide in alcoholism

Ainhoa Bilbao 1,2,#, Antonia Serrano 1,7,#,*, Andrea Cippitelli 3,#, Francisco J Pavón 1,7, Andrea Giuffrida 4, Juan Suárez 1, Nuria García-Marchena 1,5, Elena Baixeras 1, Raquel Gomez de Heras 5, Roberto Ciccocioppo 3, Benjamin F Cravatt 6, Loren H Parsons 7, Daniele Piomelli 8, Fernando Rodríguez de Fonseca 1,5,*
PMCID: PMC4668242  NIHMSID: NIHMS735402  PMID: 26037332

Abstract

Oleoylethanolamide (OEA) is a satiety factor released by the gut that controls motivational responses for caloric foods. Here, using both, rat and mice models, we determined that the administration of alcohol releases OEA that, by engaging peroxisome proliferator-activated receptor alpha (PPARα), reduces alcohol consumption. Animals lacking FAAH, the enzyme that degrades OEA, accumulates this lipid in response to ethanol and displayed reduced alcohol preference. Pharmacological administration of OEA reduced operant alcohol self-administration via a peripheral mechanism, since this effect was abrogated by chemical deafferentation with capsaicin. Intracerebral injection of PPARα agonists did not affect alcohol self-administration. OEA also abolished both, cue-induced reinstatement of alcohol self-administration and the enhancement of alcohol consumption induced by a period of alcohol deprivation, suggesting a role for OEA on alcohol relapse. In addition, animals fed with a liquid diet containing 10% alcohol displayed elevated plasma levels of OEA that decreases upon removal of alcohol in the diet. This decrease paralleled the onset of alcohol withdrawal (AWD) symptoms and the administration of OEA reduced the severity of AWD. Finally, OEA, by inhibiting the expression of lipogenic enzymes, reduces chronic alcohol-induced liver steatosis, an effect not observed in PPARα-deficient mice. These results link OEA to the homeostatic adaption to alcohol and opens new opportunities for the treatment of alcoholism.

Keywords: Oleoylethanolamide, alcoholism, alcohol self-administration, relapse, Peroxisome proliferator-activated receptor alpha, liver steatosis, rat

Introduction

Oleoylethanolamide (OEA) is a bioactive lipid mediator belonging to the fatty acid ethanolamide family (FAE). Although OEA is a structural analogue of the endocannabinoid arachidonoylethanolamide (AEA or anandamide), it neither activates nor binds to cannabinoid receptors (Fu et al., 2013; Rodriguez de Fonseca et al., 2001). In fact, OEA exerts a number of pharmacological effects, including induction of satiety, reduction of body weight gain and stimulation of lipolysis, through activation of the peroxisome proliferators-activated receptor alpha (PPARα) (Rodriguez de Fonseca et al., 2001; Fu et al., 2003; Guzman et al., 2004). OEA binds to this nuclear receptor with high affinity and its effects are absent in mice lacking PPARα (Fu et al., 2003; Guzman et al., 2004). In addition, previous reports have suggested that other receptors may also be implicated in OEA actions, including the transient receptor potential vanilloid subtype 1 (TRPV1) or the orphan G-protein coupled receptor 119 (GPR119) (Overton et al., 2006; Almasi et al., 2008).

There is a growing body of evidence to support the idea that OEA may serve as an homeostatic signal controlling multiple aspect of the intake and metabolism of high caloric foods (For review see Piomelli, 2013). OEA controls energy expenditure and fat utilization mainly through its involvement in the regulation of fat appetite (Schwartz et al, 2008), both lipid and glucose metabolism (Fu et al., 2003; Gonzalez-Yanes et al. 2005; Martinez de Ubago et al., 2008; Serrano et al., 2006 and 2011), and reward-associated to high caloric intake (Tellez et al., 2013). OEA is generated in the intestine upon arrival of food, mostly saturated/monounsaturated fats, through a process controlled by the peripheral sympathetic nervous system (Fu et al., 2007 and 2011). By engaging PPARα receptors, OEA formed in the intestine activates both sensory systems conveying information to the nucleus of the solitary tract (Rodríguez de Fonseca et al., 2011) and gut peptides that are released to the blood stream to regulate hypothalamic integrative networks controlling energy expenditure (Gaetani et al, 2010; Serrano et al., 2011). In addition in vitro and in vivo studies have demonstrated that OEA stimulates lipolysis and fatty acid oxidation through a mechanism that involves PPARα (Guzman et al., 2004; Suárez et al, 2014).

In addition to its role as an homeostatic signal controlling energy expenditure, growing evidences suggests that OEA may control motivational processes through its ability of modulating the reward system. Recent reports (Tellez et al., 2013) have established that intestinal OEA, by modulating gut sensory nerve terminals is capable to determine the level of activity of dopaminergic projections induced by the infusion of either low or high calorie emulsions. In fact, exogenous administered OEA is capable of restoring the dopaminergic deficiency associated to high fat diets, indicating that in addition to the control of appetite, OEA serves as an homeostatic signal associated to motivational drives involved in food selection. This finding is aligned with the recent description of the ability of OEA to modulate dopaminergic responses associated with nicotine self-administration (Mascia et al, 2011; Melis et al. 2008). In fact, OEA not only modulates mesocorticolimbic dopaminergic neurons, but blocks both, nicotine-induced reward and nicotine-induced nicotine self-administration through a PPARa receptor-dependent mechanism (Mascia et al., 2011). Similarly, it has been demonstrated that inhibition of fatty acid amide hydrolase (FAAH), the principal FAE-hydrolyzing enzyme which enhances the bioavailability of OEA and AEA, blocked nicotine-induced activation of neurons in the nucleus accumbens shell and ventral tegmental area (Luchicchi et al., 2010). Moreover, OEA is also capable of block the acquisition and expression of cocaine-induced conditioned place preference and cocaine-induced sensitization, indicating that this lipid transmitter is a relevant modulator of reward associated (Bilbao et al, 2013). Considering the presence of the OEA-signaling machinery in the brain, especially in the hippocampus (Rivera et al., 2014) and the description of OEA ability to modulate memory consolidation (Campolongo et al., 2009) indicates that the homeostatic role of this lipid transmitter extends to both motivational and cognitive processes associated to the hedonic valence of actions.

Taking in consideration that ethanol is both, a high-calorie food and a drug of abuse capable of modulating reward, we hypothesized that OEA might interfere with the endogenous signals activated by alcohol. There is compelling evidence that fatty acid acylethanolamides are involved in alcohol-dependence. Molecular studies have shown that acute administration of ethanol inhibits in vivo formation of AEA in the rat brain (Ferrer et al., 2007). However, chronic ethanol exposure is associated with an increased formation of AEA and FAEs precursor, as well as a down-regulation of cannabinoid CB1 receptor expression (Basavarajappa et al., 1998; Basavarajappa and Hungund, 1999; Basavarajappa et al., 2003). Several findings demonstrate that cannabinoid CB1 receptors exert a facilitory influence on ethanol preference and consumption. Consistently cannabinoid CB1 activation increases ethanol consumption in both rats (Colombo et al., 2002) and mice (Wang et al., 2003). Although the role of AEA-CB1 receptor have been shown to mediate some of the pharmacological and behavioral aspects of alcohol (Basavarajappa and Hungund, 2002; Rodriguez de Fonseca et al., 2005; Ferrer et al., 2007), the effects of non-cannabinoid compounds such as OEA have been poorly characterized, and direct experimental evidence of the behavioral significance of the OEA-PPARα interaction on ethanol-related behaviors is lacking. To address this issue, in the present study we have evaluated the effects of OEA and its receptor PPARα on alcohol-seeking behavior (ethanol self-administration and relapse) using both genetic and pharmacological approaches. These effects were also evaluated in animals after sensory deafferentation. In addition, we monitored the changes in OEA production during acute and chronic ethanol exposure and evaluated the potential cytoprotective role of OEA in liver damage produced by long-term ethanol exposure.

Methods

Animals

Main experiments were performed on male Wistar rats weighing 175–225 g. Animals were housed in groups of two in a temperature- and humidity-controlled vivarium (temperature: 22 ± 1°C; humidity: 55 ± 5%) on a reverse 12-h light/dark cycle (lights off 6:00 AM). All training and experimental sessions were conducted during the dark phase of the cycle. Standard laboratory rat chow and water were available ad libitum in the home cage, except as noted below. Additional studies were performed on adult male mice weighing 25–30 g. Both wild-type (PPARα +/+) (129S1/SvImJ, stock#002448) and PPARα-null (PPARα −/−) (129S4/SvJae-Pparatm1Gonz/J, stock #003580) mice were originally obtained from The Jackson Laboratory (Bar Harbor, ME, USA) and maintained as an inbred colony of mice (Suardiaz et al., 2007). Null FAAH allele mice (FAAH −/−) were created using homologous recombination as described previously (Cravatt et al., 2001) and were maintained on original 129/SvJ x C57BL/6J genetic background. All the studies were performed on wild-type (FAAH +/+) and homozygous knockout (FAAH −/−) littermates and generated from crosses between heterozygous animals. All animal care and experimental procedures were conducted in accordance with the European Community Directive 86/609 regulating animal research and the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Drugs

Oleoylethanolamide (OEA) was synthesized in our laboratory as previously described (Rodriguez de Fonseca et al., 2001). OEA was dissolved in a vehicle of 5% Tween-80 and 95% sterile saline and administered intraperitoneally (i.p.) in a volume of 1 mL/kg body weight in rats or 10 mL/kg body weight in mice. The following doses of OEA were used: (a) 1, 5 and 20 mg/kg for self-administration and reinstatement studies; (b) 1 and 5 mg/kg for the ethanol deprivation study; (c) 5 mg/kg for the evaluation of ethanol withdrawal signs and for the alcohol fatty liver studies.

Wy 14643 (Tocris, Bioscience, Bristol, UK) was mixed in a vehicle of 10% dimethylsulfoxide, 10% Tween-80 and 80% sterile saline. Wy 14643 was administered by i.p. in a volume of 1 mL/kg body weight and by intracerebroventricular (i.c.v.) injection in a total volume of 5 μL. The following doses were used: (a) 5, 20 and 40 mg/kg for self-administration and reinstatement studies; (b) 20 mg/kg for the ethanol deprivation study; (c) 5 and 20 mg/kg for the locomotor and anxiety tests; and (d) 1 and 10 μg for central administrations.

SR141716A (Sanofi-Synthelabo, Montpellier, France) was suspended with 2–3 drops of Tween-80 in sterile saline as vehicle. It was administered i.p. at a dose of 3 mg/kg in a volume of 1 mL/kg body weight.

Capsaicin was purchased from Sigma (St. Louis, MO, USA) and dissolved in 5% Tween-80, 5% propyleneglycol and 90% sterile saline.

Deafferentation

Capsaicin was administered subcutaneously (12.5 mg/mL) (Kaneko et al., 1998) in rats anesthetized with ethyl ether. The total dose of capsaicin (125 mg/kg) was divided into three injections (25 mg/kg in the morning and 50 mg/kg in the afternoon, and then 50 mg/kg on the next day). Control rats received vehicle injections. Experiments were performed 10 days after capsaicin treatment in rats that had lost the corneal chemosensory reflex (eye wiping for 1–3 min after application of 0.1% ammonium hydroxide into one eye).

Surgery procedure and i.c.v. drug injection

For i.c.v. injections, stainless steel guide cannulas aimed at the lateral ventricle were implanted in the rats. The animals were anesthetized with an isoflurane/oxygen vapor mixture (1.5–2.0%) and placed on a stereotaxic apparatus (David Kopf Instruments, Tujunga, CA, USA) with the incisor bar set at 5 mm above the interaural line. A guide cannula (7 mm, 23 gauge) was secured to the skull by using two stainless steel screws and dental cement and was closed with 30 gauge obturators. The implantation coordinates were relative to Bregma point: anteroposterior (AP) +0.6 mm, mediolateral (ML) ±2.0 mm, and dorsoventral (DV) −3.2 mm from the surface of the skull (Paxinos and Watson, 1998). These coordinates placed the cannula 1 mm above the ventricle. After 7 days post-surgical recovery period, cannula patency was confirmed by gravity flow of isotonic saline through a stainless steel injector (8 mm, 30 gauge) inserted within the guide to 1 mm beyond its tip. This procedure allowed the animals to become familiar with the injection technique.

For the i.c.v. administration of Wy 14643, the stylet was removed from the guide cannula of each rat and an injector connected to 70 cm of calibrated polyethylene-10 tubing was lowered into the ventricle. The tubing was then raised until flow began, and 5 μL of drug solution at doses of 1 and 10 μg was infused over a 30–60 s period. The injector was left in the guide cannula for an additional 30 s and then removed. The stylet was immediately replaced. Animals were tested 5 min after injection. The i.c.v. cannula placements were evaluated after each experiment by dye injection. Only rats with proper i.c.v. placements were included in the data analysis.

Acute ethanol administration: blood and tissue sampling

Ethanol was dissolved in sterile 0.9% (w/v) saline and administered i.p. at a dose of 4 g/kg.

For blood and visceral sampling, a group of animals was anaesthetized with methoxyflurane 0, 45, 90 or 240 min after the injection of ethanol. Blood (2 mL) was collected from the heart of the animal with a syringe filled with 1 mL of Krebs–Tris buffer (136 mM NaCl,6 mM KCl, 1.2 mM MgCl2, 2.5 mM CaCl2, 10 mM glucose and 20 mM Trizma base, pH 7.4). Blood samples were centrifuged in Accuspin tubes (Sigma, St. Louis, MO, USA) at 800×g, for 10 min at 22°C. Samples were obtained from small intestine and liver and were frozen immediately in solid CO2.

A second group of animals was anaesthetized with methoxyflurane 0, 45, 90 and 240 min after the injection of ethanol. The brains were collected after rapid decapitation and frozen immediately in solid CO2. Dissection of frozen brains was performed at −10°C. Brains were placed in acrylic rat brain matrices, and 2-mm-thick slices were obtained using brain matrix razor blades. The target brain regions were collected using a scalpel (cerebellum) or a sample corer (nucleus accumbens). The nucleus accumbens and cerebellum were dissected in 2-mm-thick frozen coronal cuts, corresponding to plates 9–13 (nucleus accumbens) and 56–65 (cerebellum) of the atlas of Paxinos and Watson (Paxinos and Watson, 1998).

Chronic ethanol administration and ethanol withdrawal: collection of rat plasma

Regular chow diet was removed and replaced by the liquid diet consisting of chocolate flavored Boost liquid nutritional supplement fortified with vitamins and minerals. Rats were separated into two groups; the ethanol group received a diet containing 10% (w/v) ethanol and the control group received an ethanol-free diet supplemented with sucrose to equalize the caloric intake in both groups. The diet was available 24 h for 21 days. On the final liquid diet day, animals were maintained in their home-cage with access to the regular chow diet and water. Blood samples were drawn at 0, 6 and 12 h after removing the liquid diet.

Ethanol withdrawal behaviors

Starting 6 h after diet with ethanol was withdrawn; animals were evaluated at hourly intervals. Rats were observed for 5 min, and withdrawal signs including general activity, shakes, tremors, mobility, spontaneous convulsive seizures and rigidity were scored.

Chronic ethanol administration: alcohol fatty liver induction

Rats received an i.p. injection of vehicle (5% Tween-80 and 95% sterile saline), OEA, ethanol or a combination of OEA and ethanol twice per day for 8 consecutive days, with each daily dose administered at 12 h intervals. OEA was dissolved in the vehicle and administered at a dose of 5 mg/kg. Ethanol was dissolved in sterile 0.9% (w/v) saline and administered at a dose of 2 g/kg (final daily dose of 4 g/kg). For the combined treatment, OEA was administered 30 min before ethanol injection.

The animals were killed 2 h after the last administration. Animals were anaesthetized (sodium pentobarbital, 50 mg/kg, i.p.) and liver samples were removed, snap-frozen in liquid nitrogen and stored at −80°C until analyses.

Plasma ethanol levels

Plasma ethanol levels were measured enzymatically using a commercial kit (Sigma, St. Louis, MO, USA). Assays were run following the manufacturer’s instructions.

HPLC–MS analyses of tissue content of OEA

OEA was extracted with methanol/chloroform (1:2, v/v) from plasma, peripheral tissues (small intestine and liver) and brain areas (nucleus accumbens and cerebellum). The recovered chloroform phases were evaporated to dryness under N2, reconstituted in a mixture of chloroform/methanol (1:3, 80 μL), and injected into the HPLC/MS for analysis and quantification. The estimated recovery of OEA was 99.7 ± 0.3%. HP 1100 Series HPLC/MS system equipped with a Hewlett-Packard octadecylsilica (ODS) Hypersil column (100×4.6 mm i.d., 5 mm) was used. Reversed phase separations were carried out by using linear increases of methanol (B) in water (A) (25% A, 75% B for 2 min; 15% A, 85% B for 3 min; 5% A, 95% B for 20 min; 100% B for 5 min) at a flow rate of 0.5 mL/min as described (Giuffrida et al., 2000). Under these conditions, analyte eluted from the column with 18.4 min of retention time. MS analyses were performed in the positive ionization mode with an electrospray ion source. Capillary voltage was set at 3.0 kV, and fragmentor voltage was 80 V. Nitrogen was used as drying gas at a flow rate of 12 L/min. The drying gas temperature was set at 350°C and the nebulizer pressure at 50 psi. For quantitative analyses, diagnostic fragments corresponding to the protonated molecules ([M+H]+) and to the sodium adducts of the molecular ions ([M+Na]+) were followed in the selected ion monitoring (SIM) mode. System control and data evaluation were conducted using on-line system software (HP Chemstation).

In vivo microdialysis studies

FAAH +/+ and FAAH −/− mice received an i.p. injection of ethanol (2 g/kg) every other day during two weeks. The day before the last injection, mice were each implanted with a single microdialysis probe into the Nucleus Accumbens (NAc) that was secured to the skull with dental cement. The stereotaxic coordinates from Bregma were +1.5 mm AP, ±0.8 mm ML, and −5.0 mm DV (from skull) (Paxinos and Watson, 1998) and the microdialysis probes employed a 1 mm length of active membranes (polyethyl sulfone membrane, 15 kDA cut off from SciPro Inc., Sanborn, NY, USA).

The probes were perfused with artificial cerebrospinal fluid delivered at 0.6 μL/min flow rate and composed of the following (in mM): 149 NaCl, 2.8 KCl, 1.2 CaCl2, 1.2 MgCl2, 0.25 ascorbic acid, 5.4 D-glucose and with 30% (w/v) hydroxypropyl-b-cyclodextrin (HP-b-CD). Inclusion of HP-b-CD in the perfusate provides a substantial increase in the dialysis recovery of endocannabinoids and related compounds. Approximately 12–16 h after probe implantation, dialysate samples were collected at 10-min intervals over 60-min baseline period and during subsequent post-treatment ethanol.

Proper placement of the active dialysis membrane within the NAc was verified histologically for each experiment. Brains were sliced (20 μm) and the placement of microdialysis probes was verified using the atlas of Paxinos (Paxinos and Watson, 1998).

RNA isolation and RT-PCR analysis

Total RNA was extracted from liver samples using Trizol Reagent (Gibco BRL Technologies, Baltimore, MD, USA), and reverse-transcribed with the Transcriptor Reverse Transcriptase kit (Transcriptor RT; Roche Diagnostics GmbH, Mannheim, Germany). The cDNA obtained from each sample was used as a template for qPCR using both the QuantiTec SYBR Green PCR Kit (Qiagen, Hilden, Germany) and the iCycler iQ Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Samples omitting reverse transcriptase were included as negative controls in each set of reactions. Primers for PCR reaction were designed based on NCBI database sequences of rat reference mRNA and checked for specificity with BLAST (Basic Local Alignment Search Tool) software from NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Primer sequences were as follows: β-glucuronidase (GUS) (forward): 5′TCCTGTACACCACCCCTACC; GUS (reverse): 5′GCCATCCTCATCCAGAAGAC; fatty acid synthase (FAS) (forward): 5′AGTTTCCGTGAGTCCATCCT; FAS (reverse): 5′TCAGGTTTCAGCCCCATAGA; stearoyl-CoA desaturase 1 (SCD-1) (forward): 5′GAAGCGAGCAACCGACAG; SCD-1 (reverse): 5′GGTGGTCGTGTAGGAACTGG. Quantification was performed with a standard curve run at the same time as the samples with each reaction run in duplicate. Absolute values from each sample were normalized with regard to the housekeeping gene GUS.

Operant training for liquid reinforcers

Training and testing were conducted in standard operant chambers located in sound-attenuating, ventilated environmental cubicles. Each chamber was equipped with a drinking reservoir (volume capacity 0.10 mL) positioned 4 cm above the grid floor in the center of the front panel of the chamber, and two retractable levers were located 3 cm to the right and left of the drinking receptacle. Auditory and visual stimuli were presented via a speaker and a light located on the front panel. A microcomputer controlled the delivery of fluids, presentation of auditory and visual stimuli, and recording of the behavioral data. Rats were trained to self-administer 10% (v/v) ethanol, 0.2% (w/v) saccharin, 10% sucrose or water in 30-min daily sessions on a fixed ratio 1 schedule of reinforcement, where each response resulted in delivery of 0.1 mL of fluid, as previously described (Weiss et al., 1993). Briefly, for the first 3 days of training, water availability in the home cage was restricted to 2 h per day in order to facilitate acquisition of operant responding for a liquid reinforcer. During this time, lever pressing reinforced by 0.2% (w/v) saccharin or 10% sucrose solution was established. At this point water was made freely available, and saccharin/sucrose self-administration training continued until animals reached stable baseline responding. Rats from the saccharin-trained group were then trained to self-administer ethanol by using a modification of the sucrose-fading procedure (Samson, 1986) that used saccharin instead of sucrose (Weiss et al., 1993). During the first 6 days of this ethanol initiation phase a 5% (w/v) ethanol solution containing 0.2% saccharin (w/v) was available to the rats. Starting on day 7, the concentration of ethanol was gradually increased from 5% to 8% and finally to 10% (w/v), whereas the concentration of saccharin was correspondingly decreased to 0%. At the beginning of the saccharin-fading procedure a second, inactive lever was introduced. During all training and testing phases responses at this lever were recorded as a measure of nonspecific behavioral activation, but they had no programmed consequences.

Saccharin and sucrose self-administration

Following completion of the saccharin or sucrose training Wistar rats were used to study the effects of OEA (0, 1, 5 and 20 mg/kg) given 30 min prior to a self-administration session. The experiment was conducted every fourth day using a Latin square counterbalanced design. Responding at the inactive lever was recorded throughout the experiment to monitor non-specific behavioral effects.

Ethanol self-administration

Following completion of the saccharin fading procedure Wistar rats were trained in sessions of 30 min per day to lever-press for 10% ethanol (0.1 mL per response) until stable baseline of responding was reached. We studied the effect of OEA (0, 1, 5 and 20 mg/kg) or Wy 14643 (0, 5, 20 and 40 mg/kg) given 30 min prior to a self-administration session. Experiments were conducted every fourth day using a Latin square counterbalanced design. Responding at the inactive lever was recorded throughout the experiment to monitor non-specific behavioral effects.

Alcohol deprivation

Rats were trained to self-administered 10% ethanol. Following 3-days of baseline responding sessions, rats were deprived of ethanol for 5 consecutive days (no operant sessions). At the end of the 5th day of the deprivation phase, rats were distributed to 4 groups and treated with vehicle, OEA (1 and 5 mg/kg) or Wy 14643 (20 mg/kg) 30 min before the test session.

Two-bottle choice test

Two-bottle choice method was used to determined voluntary ethanol consumption in mice. Animals were individually housed in standard cages and allowed to acclimate for 1 week. Each mouse had continuously access to two identical bottles, one of them always containing tap water. Food was available ad libitum. After 4 days of water consumption (both bottles), wild-type and PPARα-null mice were offered water and 10% (v/v) ethanol solution for 4 days. For wild-type and FAAH −/− mice, a choice between 3% (v/v) ethanol and water was offered for 4 days, following a choice between water and 6, 9, 12 and 15% ethanol for 4 days each. Water and ethanol consumption was recorded daily. Bottles positions were changed every day to avoid position preference. Ethanol intake (g/kg body weight for 24 h) and preference (ethanol consumption/total fluid (water plus ethanol) consumption × 100) was calculated for each mouse.

Morphine self-administration

In order to check the abilityof OEA to reduce opiate reinforcement, we used animals trained to self-administer morphine. Animals were deeply anesthetized under halothane (1.0–1.5%) and implanted with chronic indwelling catheters in the jugular vein, as previously described (Navarro et al, 2001). After a postoperative recovery period of 7 d, animals were trained to self-administer morphine on a daily basis using standard 120 min sessions. In all self-administration sessions a lever press resulted in an intravenous infusion of a 100 μl solution of morphine dissolved in saline. A white cue light above the lever indicated delivery of the opiate infusion and remained lit for a 20 sec time-out period, during which responses were recorded but not reinforced. All operant sessions were conducted during the animals’ dark cycles. The daily sessions for all the studies continued until the total number of morphine infusions per session stabilized to within ±10% for 3 consecutive days. Trained rats were used for evaluating the effects of OEA.

Reinstatement of ethanol-seeking behavior

Conditioning phase

At completion of the fading procedure, animals were trained to discriminate between 10% ethanol and water in 30 min daily sessions. Beginning with self-administration training at the 10% ethanol concentration, discriminative stimuli predictive of ethanol vs. water availability were presented during the ethanol and water self-administration sessions, respectively. The discriminative stimulus for ethanol consisted of the odor of an orange extract (S+) whereas water availability (i.e. no reward) was signaled by an anise extract (S). The olfactory stimuli were generated by placing 6–8 drops of the respective extract into the bedding of the operant chamber. In addition, each lever-press resulting in delivery of ethanol was paired with illumination of the chamber’s house light for 5 s (CS+). The corresponding cue during water sessions was a 5 s tone (70 dB) (CS). Concurrently with the presentation of these stimuli, a 5 s time-out period was in effect, during which responses were recorded but not reinforced. The olfactory stimuli serving as S+ or S for ethanol or water availability were introduced 1 min before extension of the levers and remained present throughout the 30 min sessions. The bedding of the chamber was changed and bedding trays were cleaned between sessions. The rats were only given ethanol sessions during the first 3 days of the conditioning phase. Subsequently ethanol and water sessions were conducted in random order across training days, with the constraint that all rats received a total of 10 ethanol and 10 water sessions.

Extinction phase

After the last conditioning day, rats were subjected to 30 min extinction sessions for 15 consecutive days. During this phase, sessions began by extension of the levers without presentation of the discriminative stimuli. Responses at the lever activated the delivery mechanism but did not result in the delivery of liquids or the presentation of the response-contingent cues (house light or tone).

Reinstatement testing

Reinstatement tests began the day after the last extinction session. This test lasted 30 min under conditions identical to those during the conditioning phase, except that alcohol and water were not made available. Sessions were initiated by the extension of both levers and presentation of either the ethanol S+ or water S paired stimuli. The respective discriminative stimulus remained present during the entire session and responses at the previously active lever were followed by activation of the delivery mechanism and a 5 s presentation of the CS+ in the S+ condition or the CS in the S condition. Animals were tested under the S+/CS+ condition on day 1 and under the S/CS condition on day 2. Subsequently, reinstatement experiments were conducted every fourth day (on days 6, 10 and 14), in which OEA or Wy 14643 was administered 30 min prior to the sessions. Responding at the inactive lever was constantly recorded to monitor possible non-specific behavioral effects.

Morphologic studies

Liver sections were fixed in 10% formalin, and kept in the refrigerator in 20% sacarose. For Oil Red O staining, samples were frozen and cut with a cryostat into 30 μm-thick sections, stained with freshly prepared Oil Red O working solution (0.5 g in 100 mL of isopropanol; Oil Red O working solution: 30 mL of the stock stain and 20 mL of distilled water). A light counter staining with hematoxylin was done to identify nuclei.

Statistical analysis

All data for graphs are expressed as the mean ± SEM. The different experiments included 6–10 animals per treatment according to the assay. Statistical analysis of results was performed using one- and two-way analysis of variance (ANOVA) followed by a post hoc test for multiple comparisons (Bonferroni post test). Specifically, for in vivo microdialysis studies, between-group differences in baseline dialysate OEA concentrations were first compared by ANOVA. Data were converted to the percent change from the average baseline concentration obtained prior to ethanol administration and statistical analysis was performed on the percentage data. Student’s t-tests were performed to compare baseline concentrations between genotypes. Between-groups analysis was performed by two-way repeated measures ANOVA. A p-value below 0.05 was considered statistically significant. All analysis was carried out by the computer program GraphPad Prism version 5.04 (GraphPad Software Inc., San Diego, CA, USA).

Results

Effects of ethanol administration on plasma and tissue levels of OEA

In order to identify if the presence of ethanol modified OEA levels, we evaluated the time course of the effects of acute administration of ethanol on plasma levels of ethanol and OEA as well as on OEA levels in different peripheral tissues and brain areas for a period of 240 min. The acute administration of ethanol (4 g/kg, i.p.) resulted in a rapid and marked rise in plasma ethanol levels (F4,50= 131.6; p<0.0001 thet was significant iat 45, 90 and 240 min after administration as compared to zero-time group (***p<0.001) (Fig. 1A). A decrease of plasma ethanol concentration was evident 8 h after the administration, reaching control levels within the first 24 h (data not shown). Since the plasma ethanol levels remained stable for 240 min after the exposure, we selected times of 0, 45, 90 and 240 min for the biochemical analysis of OEA in plasma and tissues. One-way ANOVA detected a significant effect on plasma OEA response to ethanol administration (F3,41= 11.55; p<0.0001), resulting in a significant increased at 90 and 240 min (***p<0.001) (Fig. 1B).

Figure 1. Effects of acute and chronic ethanol administration on plasma levels of ethanol and OEA in rats.

Figure 1

Time course of the effects of acute ethanol (4 g/kg; i.p.) at 0, 45, 90 and 240 min on plasma levels of ethanol (A) and OEA (B). Effects of 21 day exposure to an ethanol-liquid diet and withdrawal (measured at time points 6 and 12 hours post ethanol-liquid diet removal) on plasma levels of ethanol (C) and OEA (D). Data are mean ± SEM (n= 6–8 determinations per group). ***p<0.001 denotes significant differences compared with the zero-time group. ##p<0.01 and ###p<0.001 denote significant differences compared with the vehicle group. WD: withdrawal; EtOH: ethanol.

As shown in Table 1, acute ethanol also led to a rise of OEA levels in peripheral tissues and brain areas (small intestine: F3,41= 6.648; p=0.0010; liver: F3,41= 4.292; p=0.0105; nucleus accumbens: F3,41= 3.214; p=0.0335; cerebellum: F3,41= 9.435; p<0.0001). In the small intestine, the OEA increase was apparent at 45 (**p<0.01) and 90 min (*p<0.05) after the administration, and returned to control levels at 240 min. In the liver, OEA maintained control levels during the first 45 min, peaked at 90 min (**p<0.01) and returned to normal levels at 240 min. Similarly, ethanol increased OEA in the nucleus accumbens at 45 and 90 min after its administration (*p<0.05) and in the cerebellum at 90 min (***p<0.001). These results suggest that both, intestine and nucleus accumbens were the tissues where the ethanol-associated increases in OEA occurred more quickly.

Table 1.

Effects of ethanol administration on OEA levels in various tissues

Tissue Time after administration (min)
0 45 90 240
Small intestine 148.9 ± 41.8 595.4 ± 66.2** 398.1 ± 124.4* 128.1 ± 25.3
Liver 38.4 ± 5.1 34.6 ± 2.0 82.5 ± 17.9** 38.4 ± 9.1
Nucleus Accumbens 128.1 ± 67.4 610.7 ± 108.8* 582.6 ± 209.4* 265.7 ± 21.6
Cerebellum 248.2 ± 19.4 420.7 ± 75.5 610.8 ± 96.6*** 164.4 ± 17.9

Effects of acute intraperitoneal administration of ethanol (4 g/kg) on OEA levels (pmol/g of tissue)in small intestine, liver and brain sections (nucleus accumbens and cerebellum) were measured 0, 45, 90 and 240 min after injection. Data are means ± SEM (6–8 determinations per group).

*

p<0.05,

**

p<0.01 and

***

p<0.001 denote significant differences compared with zero-time group.

To evaluate the effects of chronic ethanol exposure and withdrawal on plasma level of ethanol and OEA, Wistar rats were maintained on ethanol-containing liquid diet for 21 days. These animals displayed a significant increase in plasma ethanol concentration at the end of the liquid diet exposure (###p<0.001) (Fig. 1C). This rise was still evident 6 h into withdrawal (##p<0.01). With regard to plasma OEA levels, long-term ethanol exposure induced a significant increase (##p<0.01) (Fig. 1D). This elevation of its levels in plasma was also evident following 6 and 12 h of withdrawal, but it was only significant at 6 h as compared to control group (###p<0.001).

Impact of ethanol-induced elevated OEA levels on ethanol consumption

In order to understand the meaning of ethanol-induced rises in OEA production we used fatty acid amidohydrolase knockout mice. In these animals, repeated ethanol might lead to accumulation of OEA, since FAAH is the major degrading enzyme for OEA. To this end, we evaluated in these animals both the ethanol consumption and the preference to ethanol solutions by using an ascending series of ethanol concentrations (3, 6, 9, 12 and 15%) in a two-bottle choice test. Ethanol consumption was significantly affected by genotype (F1,40=17.50; p=0.0002) and ethanol concentration (F4,40=16.79; p<0.0001). The analysis also revealed a significant interaction between genotype and ethanol concentration (F4,40=6.278; p=0.0005). FAAH −/− mice consumed significantly less ethanol than their controls at high ethanol concentrations (12% and 15%, ***p<0.001) (Fig. 2A). As shown in Figure 2B, ethanol preference was significantly affected by genotype (F1,40=4.793; p=0.0345) and ethanol concentration (F4,40=12.51; p<0.0001). The analysis also revealed a significant interaction between genotype and ethanol concentration (F4,40=5.674; p=0.0010). FAAH −/− mice displayed lower ethanol preference than their controls at high ethanol concentrations (12% and 15%, *p<0.05). Total fluid intake was not affected by OEA (see Supplementary Figure 1).

Figure 2. Effects of FAAH deletion on ethanol consumption and OEA levels in NAc.

Figure 2

FAAH −/− mice consumed less ethanol (A) and displayed lower ethanol preference (B) than wildtype mice at high ethanol concentrations. Repeated administration of alcohol ( 2gr/kg, every other day for 14 days) increased extracellular OEA levels in the nucleus accumbens of FAAH −/− but not in control mice(C). FAAH inactivation prevented the effects of ethanol on OEA levels observed after the last ethanol injection suggesting the induction of a ceiling effects on extracellular OEA levels(D). Data are mean ± SEM (n= 8–10 determinations per group). *p<0.05 and ***p<0.001 denote significant differences compared with wild-type mice. #p<0.05 denotes significant differences compared with baseline OEA in wild-type. See Supplementary figures 1 & 2 for further details.

Since the nucleus accumbens exhibited the fastest accumulation of OEA after acute administration of alcohol, we evaluated the effects of repeated ethanol administration on NAc dialysate OEA levels on FAAH +/+ and FAAH −/− mice. The effects of repeated ethanol treatment (2 mg/kg, i.p.) on NAc dialysate OEA levels in FAAH −/− and FAAH +/+ mice during 120 min are shown in Figures 2C and 2D (Experimental design can be found in Supplementary materials). Repeated ethanol administration every other day for 14 days increases basal extracellular levels of OEA (Fig. 2C and Supplementary Figure 2), leading to a ceiling effect on OEA production. The baseline OEA levels for both genotypes were 3.33 ± 0.27 nM in FAAH −/− and 1.32 ± 0.05 nM in FAAH +/+ mice resulting significantly different (***p<0.001). Finally, at 120 min post-injection OEA levels were 2.98 ± 0.64 nM in FAAH −/− and 1.65 ± 0.14 nM in FAAH +/+ (Fig. 2D). Ethanol injection (t=0) increased NAc OEA levels in FAAH +/+ mice, but not in FAAH −/− (Fig. 2D) A two-way repeated measures ANOVA detected a significant genotype effect (F1,234=36.69; p<0.0001) response, a significant time effect (F17,234=1.952; p=0.0150) and a significant interaction between genotype and time (F17,234=3.238; p<0.0001) on the OEA. The increase was significantly prolonged in FAAH +/+ mice to a maximum of 133.9 ± 12.78 % of baseline OEA at 120 min post-injection. Overall, these behavioural and biochemica results indicate that endogenously formed OEA serves as an inhibitory signal for ethanol consumption, that was time and dose-dependent.

Effects of OEA on ethanol self-administration in rats

In order to confirm the observations in FAAH knockout mice, we analyzed whether OEA affects ethanol self-administration. Wistar rats were trained to self-administer 10% ethanol and were injected with OEA (1, 5 and 20 mg/kg). OEA administration significantly decreased ethanol self-administration relative to the control condition (F3,31= 3.417; p=0.0309) with significant decreases observed after administration of both 5 and 20 mg/kg of OEA (*p<0.05) (Fig. 3A). However, these effects were also observed for sucrose (F3,31= 10.71; p<0.0001) and saccharin (F3,31= 22.85; p<0.0001) in a dose-dependent manner with significant reductions observed after administration of both 5 (sucrose: *p<0.05; saccharin: ***p<0.001 ) and 20 mg/kg of OEA (***p<0.001) (Fig. 3B–C). In contrast, OEA administration did not alter morphine (F2,23= 0.2304; n.s.) self-administration (Fig. 3D), nor cocaine self-administration (unpublished observations).

Figure 3. Effects of OEA on ethanol intake.

Figure 3

The acute i.p. injection of OEA reduced operant responses for either a 10% ethanol (A), a solution containing 10% sucrose (B) or a solution containing 0.2% saccharin (C) at 5 and 20 mg/kg, but had no effect on morphine (D) self-administration. Acute intra-accumbens injection of OEA has no effect on ethanol self-administrarion (E) This lack of central effects was also observed when the synthetic PPARα agonist Wy 14643 was injected into the lateral ventricles while its intraperitoneal administration reduced alcohol self-administration (Supplementary Figure 3). The effect of OEA on ethanol self-administration was abolished by chemical deafferentation of vagal terminals with capsaicin (F). Capsaicin pretreatment abolished the effects of OEA and Wy 14643 on ethanol self-administration but has no effect on the actions of the cannabinoid CB1 receptor antagonist SR141716A that acts centrally to reduce alcohol self-administration. Data are mean ± SEM (n= 8–10 determinations per group). *p<0.05 and ***p<0.001 denote significant differences compared with their respective control group.

Because OEA was described to reduce food intake acting peripherally, but there were reports on tits ability for modulating central dopaminergic pathways, we studied the effects of OEA when injected centrally and in animals with chemical deafferentation fo the gut. Since the nucleus accumbens was found to display quick variations on the levels of OEA after ethanol injection, we selected this area for the central injection of OEA. As it is depicted on Figure 3E, OEA injected into the nucleus accumbens was unable of modifying ethanol self-administration. However sensory deafferentation with the neurotoxin capsaicin abolished both OEA-induced reduction of operant responding for ethanol, but not that induced by the cannabinoid receptor antagonist SR141716A (Fig. 3F). Moreover, deafferentation also abolished the effects of the PPARα receptor agonist Wy 14643, that was capable of reducing ethanols self administration when injected ip, but not when infused into the lateral ventricles (See Supplementary Figure 3: central infusion of different doses of Wy 14643 (1 and 10 μg) had no effect on ethanol self-administration (F2,23= 1.616; n.s.), whereas the administration of Wy 14643 reduced ethanol self-administration at doses of 20 and 40 mg/kg (*p<0.05)).

OEA acts through PPARα receptors

Since OEA is a PPARα agonist, and Wy 14643 mimic the actions of OEA we further studied the involvement of PPARα receptors as mediators of OEA actions on alcohol consumption. First we analyzed whether the PPARα receptor antagonist GW6471 was able to reverse the decrease of ethanol ethanol consumption induced by OEA. As depicted in Figure 4A GW6471 antagonizes the decrease on ethanol consumption induced by OEA (F3,21= 2,81. p<0.05)- Subsequently, we analyzed whether genetic deletion of PPARα receptors affected ethanol preference in a two-bottle choice test. In wild type animals (Figure 4B) OEA dose dependently reduced ethanol preference.

Figure 4. The effects of OEA on alcohol intake are mediated by PPARα receptors.

Figure 4

The effects of OEA (5 mg/kg) on voluntary alcohol intake in a two-bottle choice paradigm were prevented by the pretreatment with the synthetic PPARα receptor antagonist GW6471 (5 mg/kg) (A). Deletion of PPARα receptors eliminates the reduction of alcohol preference induced by the i.p. injection of OEA in a two-bottle choice paradigm. Data are mean ± SEM (n= 8–10 determinations per group). **p<0.01 and ***p<0.001 denote significant differences compared with their respective control group.

Effects of OEA on conditioned reinstatement and alcohol deprivation

After the efficacy of OEA and Wy 14643 as modulators of the operant responses for ethanol was observed, we examined the effects of these drugs as modulators of the operant responses elicited by the contextual stimuli associated with ethanol. The relapse was induced by presenting cues associated with ethanol delivery during training. Operant responses induced by ethanol-associated stimuli (S+/CS+) were robustly increased to 19.4 ± 2.6 presses for session which was significantly different from behavior elicited under either the last day of extinction (4.5 ± 0.7 responses; ***p<0.001) or S/CS (4.4 ± 1.1 responses; ***p<0.001, Figure 5A) conditions. As shown in Figure 5B, OEA pretreatment produced a dose-dependent reduction in S+-induced ethanol seeking as compared with control group (F3,31= 9.535; p= 0.0002), with significant reductions observed following 5 and 20 mg/kg (***p<0.001). Similarly, Wy 14643 pretreatment produced a dose-dependent reduction in S+-induced ethanol seeking as compared with control group (F2,23= 8.290; p= 0.0022), with significant reductions observed following 20 (**p<0.01) and 40 mg/kg (***p<0.001). Similar to previous results, sensory deafferentation by capsaicin abolished the reduction of responses for ethanol seeking induced by OEA (Unpublished observations).

Figure 5. Effects of OEA on conditioned reinstatement and alcohol deprivation effect.

Figure 5

Conditioned responses to ethanol-associated cues (A) are reduced by the administration of either, OEA 1, 5 or 20 mg/kg) or the PPARα receptor agonist Wy 14643 (20 or 40 mg/kg). (B) Intraperitoneal administration of OEA or Wy 14643 reduced the enchanced operant ethanol responses observed after a 5-day of ethanol deprivation period (C). Data are mean ± SEM (n= 8–10 determinations per group). **p<0.01 and ***p<0.001 denote significant differences compared with their respective control group. # p<0.01versus last day of baseline.

We also evaluated the effects of PPARα agonists in an alcohol deprivation model (Fig. 5C). During the final three self-administration sessions (baseline) before the ethanol deprivation, animals obtained an average of 33.1 ± 3.0 ethanol reinforcers per session. Ethanol deprivation increased the operant responses for ethanol to 47.8 ± 4.0 responses. Subsequently, it was found that OEA administration decreased ethanol self-administration following the ethanol deprivation phase (F2,23= 13.79; p=0.0001) with significant decreases observed after administration of 5 mg/kg (***p<0.001). Similar results were observed after administration of 20 mg/kg of Wy 14643 (***p<0.001). The number of operant responses obtained after both treatment was even lower than those observed during baseline (OEA: ***p<0.001; Wy 14643: **p<0.01).

Effects of OEA on ethanol withdrawal symptoms

To further explore the effects of OEA on ethanol-related behaviors, several signs of withdrawal were scored in ethanol-dependent rats after withdrawing ethanol. As shown in Figure 6A, OEA treatment had a significant effect on ethanol withdrawal symptoms (F1,70= 34.13; p<0.0001). This analysis also revealed a significant interaction between treatment and time (F4,70= 6.734; p=0.0001). Thus, OEA administration induced a significant decrease in total score of ethanol withdrawal signs at 8 and 9 h into withdrawal (***p<0.001) when compared with vehicle-treated animals. In fact, the administration of OEA produced a significant decrease on each withdrawal symptom evaluated: vocalization, head tremor and rigidity (*p<0.05); tail tremor (**p<0.01) and body tremor (***p<0.001) (Fig. 6B).

Figure 6. Effects of OEA on ethanol withdrawal symptoms.

Figure 6

Acute administration of OEA reduced global ethanol withdrawal score measure between 6 and 12 h into withdrawal (A). This effect was observed on each symptom evaluated (B). Data are mean ± SEM (n= 8–10 determinations per group). *p<0.05, **p<0.01 and ***p<0.001 denote significant differences compared with vehicle-treated group.

Effects of OEA on alcoholic fatty liver

As chronic consumption of ethanol is associated with increased risks of fatty liver, we investigated the content and fat composition in the liver to identify any effects of OEA treatment.

As shown in Figure 7A, long-term ethanol exposure induced a significant increase in total fat content in liver as compared with vehicle (**p<0.01). However, OEA administration to these animals prevented this increase (#p<0.05). This effect was reflected in circulating triglicerides that were enhanced by ethanol, and normalized by the exogenous administration of OEA (Figure 7B). The expression of the mRNA of specific genes related to lipid metabolism was analyzed by RT-PCR in the liver of rats chronically exposed to ethanol. Control experiments showing the effectiveness of OEA treatment on the regulation of mRNA expression of known OEA targets in the liver are depicted on Supplementary Figure 5). Since alcohol modulates the pathway for lipogenesis, we analyzed both, fatty acid synthase (FAS) and stearoyl-CoA desaturase 1 (SCD-1). Gene expression of FAS, a key enzyme of fatty acid synthesis, was significantly increased by chronic ethanol (*p<0.05) as compared with vehicle-treated group (Fig. 7C), an effect counteracted by OEA. In addition, the administration of OEA to ethanol-treated rats significantly decreased the expression SCD-1, an enzyme associated with increased fat accumulation and mono-unsaturation of SFAs, as compared with ethanol group (##p<0.01) (Fig. 7D).

Figure 7. Effects of OEA on alcoholic fatty liver.

Figure 7

Effects of chronic treatment with vehicle (5% Tween-80 and 95% sterile saline), OEA (5 mg/kg), ethanol (2 g/kg) or a combination of OEA and ethanol twice per day for 8 consecutive days on hepatic lipid content (A), plasma triglycerides (B), Fatty acid synthase (FAS) mRNA expression (C), and Stearoyl Coenzyme-A desaturase-1 (SCD-1) mRNA expression (D). suggesting an OEA-induced reduction on enhanced lipogenesis induced by ethanol administration. GUS (β-glucuronidase) was used as for normalization. E–F Analysis of histological samples from the liver stained with Oil-red/Hematoxylin-eosin in both, wildtype animals (E) and PPARα receptor knockout mice (F) revealed that OEA reduced ethanol-induced lipid depots in the liver of wildtype but not in PPARα receptor knockout mice. *p<0.05, **p<0.01 and ***p<0.001 denote significant differences compared with vehicle-treated group. #p<0.05 and ##p<0.01 denote significant differences compared with the ethanol-treated group.

The biochemical analysis of fat content agreed with histological findings. Liver sections of rats exposed to chronic ethanol and stained with Hematoxylin/Oil Red O (Fig. 7E and 7F), showed prominent lipid accumulation after ethanol administration, an effect reversed by OEA in wild type mice but nor in PPARα receptor knockout mice.

DISCUSION

The present results identify a prominent role for Oleoylethanolamide as an internal homeostatic signal controlling multiple aspects of the physiological adaptations to alcohol exposure. OEA production is triggered by alcohol administration and contributes to the regulation of alcohol intake, acute motivational responses to alcohol and the control of contextual memories associated to alcohol consumption. OEA also might serve as a blood-borne signal that contributes to the metabolic adaptions to chronic alcohol consumption. Interestingly, external administration of OEA is capable of improving the deleterious effects associated with chronic alcohol exposure, indicating that either OEA or OEA-based therapies might be a potential therapeutic strategy for alcoholism.

The first interesting finding of the present study is the induction of OEA production after acute exposure to alcohol. This effect was observed in different tissues and detected on plasma samples. The intensity and time-course of alcohol-induced OEA production was time and tissue-dependent, being the small intestine (jejunum) and the nucleus accumbens the first tissues where OEA accumulation was detected. The mechanisms by which alcohol triggers OEA production in the periphery can be related to the well-known dependence of OEA production on sympathetic activity (Fu et al., 2011). Alcohol is a well know activator of the sympathetic pathway (For review see Spanagel, 2009) and activation of the sympathetic pathway has been found to increase OEA production not only in the intestine, but in metabolically-relevant tissues such as the adipose tissue (Guzman et al., 2014; Loverme et al, 2006, Fu et al. 2011). Thus, alcohol enhanced activation of the sympathetic output might be the responsible for the OEA increases observed. Since plasma and liver OEA rise is delayed with respect to intestinal accumulation, we can deduct that this effect is secondary to the activation of main sympathetic-innervated targets. Thus, alcohol-induced activation of catecholaminergic input into the small intestine might increase β–adrenergic receptor-mediated OEA formation that will be released into the circulation and reaching distant targets such as the liver. In the brain, the rapid response of the nucleus accumbens, observed either by monitoring tissue contents and extracellular levels my microdialysis indicates a direct action of alcohol in the brain. In this area alcohol can recruit either catecholaminergic, cholinergic and glutamatergic neurons (Spanagel, 2009) that in turn can trigger receptor-dependent OEA activation, as it has been described (Stella and Piomelli, 2001). This hypothesis needs to be confirmed in future studies. Finally, plasma OEA levels were found to be constantly high along chronic alcohol consumption. Removal of alcohol intake from the diet induced a decrease in OEA levels that paralleled the decrease in alcohol levels, indicating a tight association in between OEA formation and alcohol presence in the body. As we will discuss later, disappearance of OEA is related to overt alcohol withdrawal symptoms, supporting the adaptive nature of OEA as an alcohol-driven homeostatic signal necessary to adapt the body to the presence of ethanol.

OEA has been linked to physiological responses associated with high calorie intake, including the control of motivational aspects of eating and metabolic adaptions to this high calorie foods (Piomelli 2013, Schwartz et al., 2008). Supporting this hypothesis, we studied whether alcohol-induced OEA could regulate alcohol intake. First we analyzed a whether endogenous production of OEA might regulate alcohol intake. To this end we used FAAH-deficient mice (Cravatt et al., 2011). FAAH is an enzyme essential for the degradation of acylethanolamides, including OEA. Alcohol, by inducing OEA production produced OEA accumulation and this accumulation is related to the observation of a decreased alcohol preference in these mice. Our interpretation of the data is that OEA released by alcohol served as a signal that limits alcohol consumption, an effect that might appeared with the highest concentration of ethanol drank. However, in FAAH knockout mice, OEA accumulation was more rapid, constant and limited alcohol intake at much lower concentrations. Further to confirm this hypothesis we found that in another species, the rat, administration of either OEA or OEA-receptor (PPARα receptor) agonists, reduced alcohol intake and self-administration. This effect was found to be effective not only for alcohol, but for sucrose and saccharin, nut not morphine. Moreover, it was dependent on the presence of active PPARα receptors, since it can be blocked by selective PPARα antagonist and absent in PPARα deficient mice. Overall these findings indicates that, as described for fats and high calorie foods (Fu et al., 2003 & 2007; Piomelli et al., 2013; Rodriguez de Fonseca et al., 2001), OEA is capable to modulate both consumption and motivational responses for alcohol, that we have to remark, is a high calorie nutrient. These motivational aspects extend to the regulation of contextual memories associated with alcohol consumption. Interestingly both, OEA and PPARa agonists are capable of reducing cue-induced reinstatement to alcohol consumption, suggesting that after extinction, OEA has the ability of reduce motivational memories associated to alcohol effects. Whether or not this effect of OEA on contextual memories associated to alcohol is related to modulatory action that OEA exerts on memory consolidation remains to be determined (Camplongo et al., 2009).

Following the strategy used to determine the site of action of acylethanolamides for suppressing food intake (See Gomez et al., 2002; Rodriguez de Fonseca et al., 2001) we further search for the site of action of OEA to reduce alcohol self-administration. As described for food intake, the effects of OEA for reducing both, alcohol self-administration and cue-induced reinstatement, were found to be dependent on the integrity of the peripheral sensory system. Capsaicin-induced deafferentation of the small intestine abrogates OEA effects, leaving intact centrally-mediated effects of compound such as the selective cannabinoid CB1 receptor antagonist SR141716A that reduces alcohol self-administration by targeting the prefrontal cortex (Hansson et al., 2007). This was confirmed by intranucleus accumbens administration of OEA and by intracerebroventricular administration of a selective PPARα agonist in animals self-administering alcohol. Both treatments failed to reduce alcohol self-administration. Thus, we can hypothesize that alcohol, as described for high calorie foods, by releasing OEA in the intestine might activate ascending sensory pathways that finally will inhibit motivational aspects of alcohol intake (Piomelli et al., 2013; Rodriguez de Fonseca et al., 2011). The participation of the nucleus of the solitary tract, and its connections with oxytocinergic (Gaetani et al., 2010) and histaminergic (Provensi et al, 2014) systems, that further mediated OEA-induced feeding inhibition, will be addressed in future studies.

Following the observation of the decrease in plasma OEA along ethanol withdrawal we observed that this decline paralleled the onset of alcohol withdrawal symptoms. External injection of OEA at the beginning of withdrawal, when OEA levels dropped, induced a clear reduction on the severity of behavioural symptoms associated to withdrawal. At the present moment we do not know whether this finding reflects an intrinsic ability for OEA to reduce hyperexcitability associated to ethanol withdrawal. Although OEA has been find to interact with ion channels regulating excitability, we cannot discard further actions in targets recruited by alcohol withdrawal, that includes peptidergic, aminoacidergic and classical neurotransmitter systems. However, the reduction of motivational impact of ethanol-associated cues, as well as that of the severity of alcohol withdrawal symptoms by a single molecule such as OEA, gives an unique profile for a future design of therapies against alcoholism.

Finally, since OEA has been described to regulate lipid metabolism, as a PPARα agonist (Fu et al., 2013; Serrano et al. 2006 & 2008), we analyzed whether OEA administration was capable of reducing the impact of alcohol in the liver. Previously, we have described a cytoprotective role of OEA in a new model of liver steatosis associated with changes in fatty acid composition and desaturase expression (Serrano et al., 2006). OEA administration reduced fat accumulation in animals exposed to an ethanol liquid diet, reduced circulating triglycerides, and modulated the expression of lipogenic enzymes. These effects were associated with clear histological improvement in liver steatosis and were similar to those described previously in different models of steatosis associated to obesity (Fu et al., 2005; Serrano et al., 2008). Moreover, the beneficial actions of OEA were absent in PPARα knockout mice, that exhibited a severe hepatic steatosis after alcohol intake and that were unresponsive to exogenous administration of this lipid mediator.

In conclusion, we determined that OEA is an endogenous signal that participates on the homeostatic adaption to alcohol. Its actions cover multiple physiological aspects including motivational, metabolic and cytoprotective ones. Overall, OEA actions set in place a new track for the development of effective therapies in alcoholism

Supplementary Material

Acknowledgments

The present study has been supported by the following grants from the Ministerio de Economía y Competitividad: Instituto de Salud ‘Carlos III’ (PI13/02261) and Red de Trastornos Adictivos EU-ERDF (RD2012/0028/0001. Grant EU-ERDF PAIDI CTS-433 and grant PI45403 from the Andalusian Ministry of Economy, Science and Innovation; Grant PI0228-2013 from Consejería de Salud y Bienestar Social, Junta Andalucía; Plan Nacional sobre Drogas Grants 049/2009 and 049/2013 and NIH/NIAAA grants P60AA006420 and RO1AA022249.

References

  1. Almasi R, Szoke E, Bolcskei K, Varga A, Riedl Z, Sandor Z, Szolcsanyi J, Petho G. Actions of 3-methyl-N-oleoyldopamine, 4-methyl-N-oleoyldopamine and N-oleoylethanolamide on the rat TRPV1 receptor in vitro and in vivo. Life Sci. 2008;82:644–651. doi: 10.1016/j.lfs.2007.12.022. [DOI] [PubMed] [Google Scholar]
  2. Basavarajappa BS, Hungund BL. Chronic ethanol increases the cannabinoid receptor agonist anandamide and its precursor N-arachidonoylphosphatidylethanolamine in SK-N-SH cells. J Neurochem. 1999;72:522–528. doi: 10.1046/j.1471-4159.1999.0720522.x. [DOI] [PubMed] [Google Scholar]
  3. Basavarajappa BS, Hungund BL. Neuromodulatory role of the endocannabinoid signaling system in alcoholism: an overview. Prostaglandins Leukot Essent Fatty Acids. 2002;66:287–299. doi: 10.1054/plef.2001.0352. [DOI] [PubMed] [Google Scholar]
  4. Basavarajappa BS, Cooper TB, Hungund BL. Chronic ethanol administration down-regulates cannabinoid receptors in mouse brain synaptic plasma membrane. Brain Res. 1998;793:212–218. doi: 10.1016/s0006-8993(98)00175-9. [DOI] [PubMed] [Google Scholar]
  5. Basavarajappa BS, Saito M, Cooper TB, Hungund BL. Chronic ethanol inhibits the anandamide transport and increases extracellular anandamide levels in cerebellar granule neurons. Eur J Pharmacol. 2003;466:73–83. doi: 10.1016/s0014-2999(03)01557-7. [DOI] [PubMed] [Google Scholar]
  6. Bilbao A, Blanco E, Luque-Rojas MJ, Suarez J, Palomino A, Vida M, Araos P, Bermudez-Silva FJ, Fernandez-Espejo E, Spanagel R, Rodriguez de Fonseca F. Oleoylethanolamide dose-dependently attenuates cocaine-induced behaviours through a PPARalpha receptor-independent mechanism. Addict Biol. 2013;18:78–87. doi: 10.1111/adb.12006. [DOI] [PubMed] [Google Scholar]
  7. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37:911–917. doi: 10.1139/o59-099. [DOI] [PubMed] [Google Scholar]
  8. Campolongo P, Roozendaal B, Trezza V, Cuomo V, Astarita G, Fu J, McGaugh JL, Piomelli D. Fat-induced satiety factor oleoylethanolamide enhances memory consolidation. Proc Natl Acad Sci U S A. 2009;106:8027–8031. doi: 10.1073/pnas.0903038106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Colombo G, Serra S, Brunetti G, Gomez R, Melis S, Vacca G, Carai MM, Gessa L. Stimulation of voluntary ethanol intake by cannabinoid receptor agonists in ethanol-preferring sP rats. Psychopharmacology (Berl) 2002;159:181–187. doi: 10.1007/s002130100887. [DOI] [PubMed] [Google Scholar]
  10. Cravatt BF, Demarest K, Patricelli MP, Bracey MH, Giang DK, Martin BR, Lichtman AH. Supersensitivity to anandamide and enhanced endogenous cannabinoid signaling in mice lacking fatty acid amide hydrolase. Proc Natl Acad Sci U S A. 2001;98:9371–9376. doi: 10.1073/pnas.161191698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Ferrer B, Bermudez-Silva FJ, Bilbao A, Alvarez-Jaimes L, Sanchez-Vera I, Giuffrida A, Serrano A, Baixeras E, Khaturia S, Navarro M, Parsons LH, Piomelli D, Rodriguez de Fonseca F. Regulation of brain anandamide by acute administration of ethanol. Biochem J. 2007;404:97–104. doi: 10.1042/BJ20061898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fu J, Astarita G, Gaetani S, Kim J, Cravatt BF, Mackie K, Piomelli D. Food intake regulates oleoylethanolamide formation and degradation in the proximal small intestine. J Biol Chem. 2007;282:1518–28. doi: 10.1074/jbc.M607809200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fu J, Dipatrizio NV, Guijarro A, Schwartz GJ, Li X, Gaetani S, Astarita G, Piomelli D. Sympathetic activity controls fat-induced oleoylethanolamide signaling in small intestine. J Neurosci. 2011;31:5730–6. doi: 10.1523/JNEUROSCI.5668-10.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fu J, Gaetani S, Oveisi F, Lo Verme J, Serrano A, Rodriguez De Fonseca F, Rosengarth A, Luecke H, Di Giacomo B, Tarzia G, Piomelli D. Oleylethanolamide regulates feeding and body weight through activation of the nuclear receptor PPAR-alpha. Nature. 2003;425:90–93. doi: 10.1038/nature01921. [DOI] [PubMed] [Google Scholar]
  15. Fu J, Oveisi F, Gaetani S, Lin E, Piomelli D. Oleoylethanolamide, an endogenous PPAR-alpha agonist, lowers body weight and hyperlipidemia in obese rats. Neuropharmacology. 2005;48:1147–1153. doi: 10.1016/j.neuropharm.2005.02.013. [DOI] [PubMed] [Google Scholar]
  16. Gaetani S, Fu J, Cassano T, Dipasquale P, Romano A, Righetti L, Cianci S, Laconca L, Giannini E, Scaccianoce S, Mairesse J, Cuomo V, Piomelli D. The fat-induced satiety factor oleoylethanolamide suppresses feeding through central release of oxytocin. J Neurosci. 2010;30:8096–8101. doi: 10.1523/JNEUROSCI.0036-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Galan-Rodriguez B, Suarez J, Gonzalez-Aparicio R, Bermudez-Silva FJ, Maldonado R, Robledo P, Rodriguez de Fonseca F, Fernandez-Espejo E. Oleoylethanolamide exerts partial and dose-dependent neuroprotection of substantia nigra dopamine neurons. Neuropharmacology. 2009;56:653–664. doi: 10.1016/j.neuropharm.2008.11.006. [DOI] [PubMed] [Google Scholar]
  18. Giuffrida A, Rodriguez de Fonseca F, Piomelli D. Quantification of bioactive acylethanolamides in rat plasma by electrospray mass spectrometry. Anal Biochem. 2000;280:87–93. doi: 10.1006/abio.2000.4509. [DOI] [PubMed] [Google Scholar]
  19. Gomez R, Navarro M, Ferrer B, Trigo JM, Bilbao A, Del Arco I, Cippitelli A, Nava F, Piomelli D, Rodriguez de Fonseca F. A peripheral mechanism for CB1 cannabinoid receptor-dependent modulation of feeding. J Neurosci. 2002;22:9612–9617. doi: 10.1523/JNEUROSCI.22-21-09612.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gonzalez-Yanes C, Serrano A, Bermudez-Silva FJ, Hernandez-Dominguez M, Paez-Ochoa MA, Rodriguez de Fonseca F, Sanchez-Margalet V. Oleylethanolamide impairs glucose tolerance and inhibits insulin-stimulated glucose uptake in rat adipocytes through p38 and JNK MAPK pathways. Am J Physiol Endocrinol Metab. 2005;289:E923–929. doi: 10.1152/ajpendo.00555.2004. [DOI] [PubMed] [Google Scholar]
  21. Guzman M, Lo Verme J, Fu J, Oveisi F, Blazquez C, Piomelli D. Oleoylethanolamide stimulates lipolysis by activating the nuclear receptor peroxisome proliferator-activated receptor alpha (PPAR-alpha) J Biol Chem. 2004;279:27849–27854. doi: 10.1074/jbc.M404087200. [DOI] [PubMed] [Google Scholar]
  22. Hansson AC, Bermúdez-Silva FJ, Malinen H, Hyytiä P, Sanchez-Vera I, Rimondini R, Rodriguez de Fonseca F, Kunos G, Sommer WH, Heilig M. Genetic impairment of frontocortical endocannabinoid degradation and high alcohol preference. Neuropsychopharmacology. 2007;32:117–26. doi: 10.1038/sj.npp.1301034. [DOI] [PubMed] [Google Scholar]
  23. Kaneko H, Kaunitz J, Tache Y. Vagal mechanisms underlying gastric protection induced by chemical activation of raphe pallidus in rats. Am J Physiol. 1998;275:G1056–1062. doi: 10.1152/ajpgi.1998.275.5.G1056. [DOI] [PubMed] [Google Scholar]
  24. LoVerme J, Guzmán M, Gaetani S, Piomelli D. Cold exposure stimulates synthesis of the bioactive lipid oleoylethanolamide in rat adipose tissue. J Biol Chem. 2006;281:22815–8. doi: 10.1074/jbc.M604751200. [DOI] [PubMed] [Google Scholar]
  25. Luchicchi A, Lecca S, Carta S, Pillolla G, Muntoni AL, Yasar S, Goldberg SR, Pistis M. Effects of fatty acid amide hydrolase inhibition on neuronal responses to nicotine, cocaine and morphine in the nucleus accumbens shell and ventral tegmental area: involvement of PPAR-alpha nuclear receptors. Addict Biol. 2010;15:277–288. doi: 10.1111/j.1369-1600.2010.00222.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Martinez de Ubago M, Garcia-Oya I, Perez-Perez A, Canfran-Duque A, Quintana-Portillo R, Rodriguez de Fonseca F, Gonzalez-Yanes C, Sanchez-Margalet V. Oleoylethanolamide, a natural ligand for PPAR-alpha, inhibits insulin receptor signalling in HTC rat hepatoma cells. Biochim Biophys Acta. 2009;1791:740–745. doi: 10.1016/j.bbalip.2009.03.014. [DOI] [PubMed] [Google Scholar]
  27. Mascia P, Pistis M, Justinova Z, Panlilio LV, Luchicchi A, Lecca S, Scherma M, Fratta W, Fadda P, Barnes C, Redhi GH, Yasar S, Le Foll B, Tanda G, Piomelli D, Goldberg SR. Blockade of nicotine reward and reinstatement by activation of alpha-type peroxisome proliferator-activated receptors. Biol Psychiatry. 2011;69:633–641. doi: 10.1016/j.biopsych.2010.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Melis M, Pillolla G, Luchicchi A, Muntoni AL, Yasar S, Goldberg SR, Pistis M. Endogenous fatty acid ethanolamides suppress nicotine-induced activation of mesolimbic dopamine neurons through nuclear receptors. J Neurosci. 2008;28:13985–13994. doi: 10.1523/JNEUROSCI.3221-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Moreno-Santos I, Pavón FJ, Romero-Cuevas M, Serrano A, Cano C, Suardíaz M, Decara J, Suarez J, de Fonseca FR, Macías-González M. Computational and biological evaluation of N-octadecyl-N′-propylsulfamide, a selective PPARα agonist structurally related to N-acylethanolamines. PLoS One. 2014;9:e92195. doi: 10.1371/journal.pone.0092195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Navarro M, Carrera MR, Fratta W, Valverde O, Cossu G, Fattore L, Chowen JA, Gomez R, del Arco I, Villanua MA, Maldonado R, Koob GF, Rodriguez de Fonseca F. Functional interaction between opioid and cannabinoid receptors in drug self-administration. J Neurosci. 2001;21:5344–5350. doi: 10.1523/JNEUROSCI.21-14-05344.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Overton HA, Babbs AJ, Doel SM, Fyfe MC, Gardner LS, Griffin G, Jackson HC, Procter MJ, Rasamison CM, Tang-Christensen M, Widdowson PS, Williams GM, Reynet C. Deorphanization of a G protein-coupled receptor for oleoylethanolamide and its use in the discovery of small-molecule hypophagic agents. Cell Metab. 2006;3:167–175. doi: 10.1016/j.cmet.2006.02.004. [DOI] [PubMed] [Google Scholar]
  32. Pavón FJ, Araos P, Pastor A, Calado M, Pedraz M, Campos-Cloute R, Ruiz JJ, Serrano A, Blanco E, Rivera P, Suárez J, Romero-Cuevas M, Pujadas M, Vergara-Moragues E, Gornemann I, Torrens M, de la Torre R, Rodríguez de Fonseca F. Evaluation of plasma-free endocannabinoids and their congeners in abstinent cocaine addicts seeking outpatient treatment: impact of psychiatric co-morbidity. Addict Biol. 2013;18:955–69. doi: 10.1111/adb.12107. [DOI] [PubMed] [Google Scholar]
  33. Paxinos G, Watson C. The Rat Brain in Stereotaxic Coordinates. New York: Academic Press, Spiral Bound; 1998. [Google Scholar]
  34. Piomelli D. A fatty gut feeling. Trends Endocrinol Metab. 2013;24:332–341. doi: 10.1016/j.tem.2013.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Plaza-Zabala A, Berrendero F, Suarez J, Bermudez-Silva FJ, Fernandez-Espejo E, Serrano A, Pavon FJ, Parsons LH, De Fonseca FR, Maldonado R, Robledo P. Effects of the endogenous PPAR-alpha agonist, oleoylethanolamide on MDMA-induced cognitive deficits in mice. Synapse. 2010;64:379–389. doi: 10.1002/syn.20733. [DOI] [PubMed] [Google Scholar]
  36. Provensi G, Coccurello R, Umehara H, Munari L, Giacovazzo G, Galeotti N, Nosi D, Gaetani S, Romano A, Moles A, Blandina P, Passani MB. Satiety factor oleoylethanolamide recruits the brain histaminergic system to inhibit food intake. Proc Natl Acad Sci U S A. 2014 Jul 21; doi: 10.1073/pnas.1322016111. pii: 201322016. [Epub ahead of print] [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rodriguez de Fonseca F, Del Arco I, Bermudez-Silva FJ, Bilbao A, Cippitelli A, Navarro M. The endocannabinoid system: physiology and pharmacology. Alcohol Alcohol. 2005;40:2–14. doi: 10.1093/alcalc/agh110. [DOI] [PubMed] [Google Scholar]
  38. Rodriguez de Fonseca F, Navarro M, Gomez R, Escuredo L, Nava F, Fu J, Murillo-Rodriguez E, Giuffrida A, LoVerme J, Gaetani S, Kathuria S, Gall C, Piomelli D. An anorexic lipid mediator regulated by feeding. Nature. 2001;414:209–212. doi: 10.1038/35102582. [DOI] [PubMed] [Google Scholar]
  39. Rivera P, Arrabal S, Vargas A, Blanco E, Serrano A, Pavón FJ, Rodríguez de Fonseca F, Suárez J. Localization of peroxisome proliferator-activated receptor alpha (PPARα) and N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD) in cells expressing the Ca(2+)-binding proteins calbindin, calretinin, and parvalbumin in the adult rat hippocampus. Front Neuroanat. 2014 Mar 17;8:12. doi: 10.3389/fnana.2014.00012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Samson HH. Initiation of ethanol reinforcement using a sucrose-substitution procedure in food- and water-sated rats. Alcohol Clin Exp Res. 1986;10:436–442. doi: 10.1111/j.1530-0277.1986.tb05120.x. [DOI] [PubMed] [Google Scholar]
  41. Schwartz GJ, Fu J, Astarita G, Li X, Gaetani S, Campolongo P, Cuomo V, Piomelli D. The lipid messenger OEA links dietary fat intake to satiety. Cell Metab. 2008;8:281–288. doi: 10.1016/j.cmet.2008.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Serrano A, Del Arco I, Javier Pavón F, Macías M, Perez-Valero V, Rodríguez de Fonseca F. The cannabinoid CB1 receptor antagonist SR141716A (Rimonabant) enhances the metabolic benefits of long-term treatment with oleoylethanolamide in Zucker rats. Neuropharmacology. 2008;54:226–34. doi: 10.1016/j.neuropharm.2007.03.007. [DOI] [PubMed] [Google Scholar]
  43. Serrano A, Pavon FJ, Tovar S, Casanueva F, Senaris R, Dieguez C, de Fonseca FR. Oleoylethanolamide: effects on hypothalamic transmitters and gut peptides regulating food intake. Neuropharmacology. 2011;60:593–601. doi: 10.1016/j.neuropharm.2010.12.007. [DOI] [PubMed] [Google Scholar]
  44. Serrano A, Pavon FJ, del Arco I, Rojo-Martinez G, valenzuela m, Bermudez-Silva FJ, Soriguer F, Rodriguez de Fonseca F. Oleoylethanolamide reverses changes in both fatty acid composition and desaturase mRNA expression in a new model of liver steatosis. Obesity and Metabolism-Milan. 2006;2:155–164. [Google Scholar]
  45. Spanagel R. Alcoholism: a systems approach from molecular physiology to addictive behavior. Physiol Rev. 2009;89:649–705. doi: 10.1152/physrev.00013.2008. [DOI] [PubMed] [Google Scholar]
  46. Stella N, Piomelli D. Receptor-dependent formation of endogenous cannabinoids in cortical neurons. Eur J Pharmacol. 2001 Aug;425:189–96. doi: 10.1016/s0014-2999(01)01182-7. [DOI] [PubMed] [Google Scholar]
  47. Su HF, Samsamshariat A, Fu J, Shan YX, Chen YH, Piomelli D, Wang PH. Oleylethanolamide activates Ras-Erk pathway and improves myocardial function in doxorubicin-induced heart failure. Endocrinology. 2006;147:827–834. doi: 10.1210/en.2005-1098. [DOI] [PubMed] [Google Scholar]
  48. Suardiaz M, Estivill-Torrus G, Goicoechea C, Bilbao A, Rodriguez de Fonseca F. Analgesic properties of oleoylethanolamide (OEA) in visceral and inflammatory pain. Pain. 2007;133:99–110. doi: 10.1016/j.pain.2007.03.008. [DOI] [PubMed] [Google Scholar]
  49. Suárez J, Rivera P, Arrabal S, Crespillo A, Serrano A, Baixeras E, Pavón FJ, Cifuentes M, Nogueiras R, Ballesteros J, Dieguez C, Rodríguez de Fonseca F. Oleoylethanolamide enhances β-adrenergic-mediated thermogenesis and white-to-brown adipocyte phenotype in epididymal white adipose tissue in rat. Dis Model Mech. 2014;7:129–141. doi: 10.1242/dmm.013110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tellez LA, Medina S, Han W, Ferreira JG, Licona-Limón P, Ren X, Lam TT, Schwartz GJ, de Araujo IE. A gut lipid messenger links excess dietary fat to dopamine deficiency. Science. 2013;341:800–802. doi: 10.1126/science.1239275. [DOI] [PubMed] [Google Scholar]
  51. Wang L, Liu J, Harvey-White J, Zimmer A, Kunos G. Endocannabinoid signaling via cannabinoid receptor 1 is involved in ethanol preference and its age-dependent decline in mice. Proc Natl Acad Sci U S A. 2003;100:1393–1398. doi: 10.1073/pnas.0336351100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Weiss F, Lorang MT, Bloom FE, Koob GF. Oral alcohol self-administration stimulates dopamine release in the rat nucleus accumbens: genetic and motivational determinants. J Pharmacol Exp Ther. 1993;267:250–258. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

RESOURCES