Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Details of the genes and their primers involved in this study
| Gene | region | Chr Region | SNP | rs no | Forward Primer | Reverse Primer | Amplicon Size | Detection Method |
|---|---|---|---|---|---|---|---|---|
| TCF7L2 | Intron 3 | 10q25 | C>T | rs7903146 | ACAATTAGAGAGCTAAGCACTTTTTAGGTA | GTGAAGTGCCCAAGCTTCTC | 188/158 | RsaI |
| SLC30A8 | Exon 8 | 8q24.11 | C>T | rs13266634 | GAAGTTGGAGTCAGAGCAGTC | TGGCCTGTCAAATTTGGGAA | 256/176/80 | HpaII |
| IGF2 | Exon 9 | 11p15.5 | A>G | rs680 | CTTGGACTTTGAGTCAAATTGG | GGTCGTGCCAA TTACATTTCA | 292/229 | ApaI |
