Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2015 Dec 4;5:17770. doi: 10.1038/srep17770

Characterization of Pseudooxynicotine Amine Oxidase of Pseudomonas putida S16 that Is Crucial for Nicotine Degradation

Haiyang Hu 1,2, Weiwei Wang 1,2, Hongzhi Tang 1,2,a, Ping Xu 1,2
PMCID: PMC4669500  PMID: 26634650

Abstract

Pseudooxynicotine amine oxidase (Pnao) is essential to the pyrrolidine pathway of nicotine degradation of Pseudomonas putida strain S16, which is significant for the detoxification of nicotine, through removing the CH3NH2 group. However, little is known about biochemical mechanism of this enzyme. Here, we characterized its properties and biochemical mechanism. Isotope labeling experiments provided direct evidence that the newly introduced oxygen atom in 3-succinoylsemialdehyde-pyridine is derived from H2O, but not from O2. Pnao was very stable at temperatures below 50 °C; below this temperature, the enzyme activity increased as temperature rose. Site-directed mutagenesis studies showed that residue 180 is important for its thermal stability. In addition, tungstate may enhance the enzyme activity, which has rarely been reported before. Our findings make a further understanding of the crucial Pnao in nicotine degradation.


Tobacco consumption is not only an important pillar of the national economy of China, but also a leading preventable cause of diseases such as lung cancer1,2,3. Nicotine is the major toxic component of tobacco, and it is capable of crossing biological membranes. When tobacco is burned, nicotine is transformed into tobacco-specific nitrosamines (TSNAs)4,5,6,7. One of the most toxic TSNAs, 4-methylnitrosamino-l-(3-pyridyl)-l-butanone (NNK), can be generated from pseudooxynicotine (PN) through nitrosation8,9. PN is an intermediate product in the nicotine degradation pathway of Pseudomonas putida strain S16. Our previous studies showed that strain S16 is a nicotine-metabolizing microorganism that transforms nicotine to 2,5-dihydroxypyridine through N-methyl-myosmine, pseudooxynicotine, and 3-succinoylpyridine (SP)10,11,12,13. A pseudooxynicotine amine oxidase (Pnao) gene has been identified, and the encoded protein could detoxify PN by removing the CH3NH2 group;14,15 when the encoded gene pnao was deleted, the pathway of nicotine degradation was blocked, showing this is a critical step for nicotine detoxification by Pseudomonas15. In previous studies, only the product and the prosthetic group of Pnao were identified14. Thus, little is known about Pnao and its mechanism(s) of action.

In this study, His6-tagged Pnao was heterologously expressed and purified from Escherichia coli, and then characterized. The oxygen atom added to 3-succinoylsemialdehyde-pyridine (SAP) originates from H2O; O2 is involved in the oxidation of FADH2. We also found that Pnao possesses some special properties, such as thermal stability below 50 °C, promotion of enzyme activity by Na2WO4, and inhibition by Na2MoO4 and FeCl3. The work described here provides a basis for future studies aimed at determining the enzymatic mechanisms of nicotine detoxification.

Results

Expression and purification of Pnao

A 1-mL solution containing 10 mg/mL Pnao was purified from a 3-L overnight culture of E. coli cells. SDS-PAGE and Superdex200 column analysis (Fig. 1A) showed that the purified Pnao has a molecular mass of approximately 54 kDa, which corresponds to the molecular mass deduced from the protein sequence. The apparent Km, kcat and kcat/Km values for PN at 30 °C were 0.073 ± 0.018 mM, 0.790 ± 0.074 s−1, 10.822 L mol−1 s−1, respectively (Fig. 1B).

Figure 1. Biochemical characterization by enzymatic assays of Pnao.

Figure 1

(A) Spectrum curve of Pnao on gel filtration. The column (superdex 200) was marked by a standard protein (Ovalbumin, 48.1 kDa). (B) Kinetic curve of Pnao at 30 °C. The apparent Km, kcat and kcat/Km values for PN at 30 °C are 0.073 ± 0.018 mM, 0.790 ± 0.074 s−1, 10.822 L mol−1 s−1, respectively. (C) Effect of pH on Pnao activity (with immediate detection). (D) Effect of pH on Pnao stability (with overnight incubation). The enzyme was incubated in buffers overnight. (E,F) Effects of metal salts on Pnao activity (with immediate detection) and Pnao stability (with overnight incubation). Metal salts: NaCl, NiCl2, BaCl2, CoCl2, CaCl2, CuCl2, MnCl2, ZnCl2, KCl, Na2MoO4, Na2WO4, CdCl2, BdCl2, FeCl3 and MgCl2. CK, without metal salts. The final concentration of metal salts was 2 mM.

Measurement of Pnao activity

(a) Effect of pH on Pnao activity. Pnao showed the highest specific enzyme activity at pH 8.5 in Na2HPO3-NaH2PO3 buffer, and the enzyme activity in this buffer was much higher than that in the other tested buffers. Thus, in subsequent experiments, Pnao enzyme activity was measured in 25 mM Na2HPO3-NaH2PO3 buffer at pH 8.5 (Fig. 1C).

(b) Effects of metal salts on Pnao activity. Na2MoO4 and FeCl3 strongly inhibited the enzyme activity. In contrast, the enzyme activity was nearly twice as high in the presence of Na2WO4 as that in its absence (Fig. 1E). However, according to the ICP results, there was no difference between the protein solution (0.5938 ppb) and the control group (0.2619 ppb), indicating that Na2WO4 is not a prosthetic group. Therefore, the function of Na2WO4 during the reaction remains to be determined.

The stability of Pnao

(a) Effect of pH on Pnao stability. Pnao enzyme activity was measured after incubation in buffers at 25 °C overnight. Maximal activity was observed after incubation at pH 7.5 (Fig. 1D). Thus Pnao was stored in Tris-HCl buffer pH 7.5.

(b) Effects of metal salts on Pnao stability. The enzyme was incubated in the solutions at 25 °C overnight. Most of the tested metal salts inhibited enzyme activity to different degrees, and Pnao showed very low activity in the presence of Na2MoO4 or FeCl3. In the presence of Na2WO4, Pnao showed the same activity as that reported in the activity assay (Fig. 1F).

(c) Effect of temperature on Pnao stability. To confirm the critical degeneration temperature, Pnao stability was monitored by circular dichroism spectroscopy (CDS). The analysis showed that Pnao began to degenerate at temperatures above 45 °C (Fig. 2A). At temperatures above 50 °C, Pnao quickly denatured. However, at temperatures from 30 °C to 60 °C, Pnao enzyme activity increased (Fig. S1). Therefore, according to these results, Pnao was stable below 45 °C.

Figure 2. Pnao characteristics by circular dichroism spectrometer (CDS).

Figure 2

(A) Spectrum of wild-type Pnao on CDS analysis. The curve started to change at temperature above 50 °C. (B) The spectrum of mutant Glu180Gly on CDS analysis. The curve started to change at temperature above 25 °C.

Identification of prosthetic groups

The purified protein appeared yellow, indicating that it is bound to FAD or FMN as a cofactor. The retention time of a compound from the supernatant from a boiled protein solution in HPLC was approximately 6 min, which is similar to that of a standard solution of FAD and different from that of a standard solution of FMN. The maximum UV-Vis absorbance peaks of the supernatant were at 376 nm and 460 nm, which was the same as that of a standard solution of FAD (Fig. S2). These results indicated that FAD was the cofactor associated with Pnao. However, Pnao activity did not show an evident increase after adding additional FAD, which indicates that Pnao was already saturated with FAD.

Site-directed mutagenesis of Pnao

Mutants of Pnao were purified by the same way of wildtype (Fig. 3A). When the enzyme activity of the mutants was assessed in the standard system at 45 °C, the Pro180Ser mutant was the only mutant that was extremely unstable. Thus, we analyzed Pro180Ser by CDS. The curve indicated that the structure of the Pro180Ser mutant changed at approximately 20 °C (Fig. 2B). Thus, we predict that Pro180Ser site is a very important residue for Pnao thermal stability.

Figure 3. SDS-PAGE analysis of site-directed mutagenesis proteins and FAD content detection of Pnao.

Figure 3

(A) SDS-PAGE analysis of purified wildtype Pnao, PnaoE131G, PnaoP149S, PnaoE159G, PnaoE162G, PnaoE174G and PnaoP180S. M, marker protein; 1, wildtype Pnao; 2, purified PnaoE131G; 3, purified PnaoP149S; 4, purified PnaoE159G; 5, purified PnaoE162G; 6 purified PnaoE174G; and 7, purified PnaoP180S. (B) FAD content of wildtype, mutants and Pnao with different metal salts. C, control group; W, tungsten; Mo, molybdenum; Fe, ferric iron.

Reaction mechanism of Pnao

In the LC-MS analysis, a molecular peak was observed at m/z 164 in the control, which indicated that the product was SAP. A similar peak was observed for the 18O2 group (Fig. 4A,B). In contrast, a molecular peak at m/z 166 and a small peak at m/z 164 were observed for the H218O group (Fig. 4C), suggesting that the oxygen added to SAP is derived from H2O. We detected the products of a Pnao standard system using an H2O2 detection kit (Sangon Biotech, Shanghai, China). An evident color change was observed, indicating that H2O2 is one of the products of the reaction. When we performed the reaction in an anaerobic environment, no H2O2 was detected. These results exhibit that O2 and H2O are both involved in the reaction and that the oxygen atom in SAP originates from H2O.

Figure 4. Mechanism of Pnao reaction as determined by LC-MS analysis.

Figure 4

(A) The control group. A molecular peak was observed at m/z 164, which is the same as molecular weight of SAP. (B) The 18O2 group. A molecular peak was also observed at m/z 164, which means that O2 is not the source of the newly introduced oxygen atom. (C) The H218O group. A molecular peak was observed at m/z 166. Thus we inferred that the newly introduced oxygen atom of succinate is derived from H2O not from O2. (D) A general view of the reaction process of Pnao. In the first step, PN is activated via the reduction of FAD and a carbon-nitrogen double bond is formed. Then, H2O attaches the carbon-nitrogen double bond and a hypothetic, extremely unstable intermediate is generated. This intermediate is transformed to SAP and CH3NH2 quickly. Finally, FAD is regenerated via the oxidation to make preparation for the next reaction.

Discussion

The mechanism of nicotine degradation in Pseudomonas provides a basis for the disposal of tobacco wastes. In our previous study, we identified a novel gene in P. putida strain S16 whose product is involved in the transformation of PN into SAP during nicotine degradation15. The encoded enzyme Pnao can attack the CH-NH bond and remove the CH3NH2 group from PN. The generated intermediates are less toxic and cannot easily be transformed into carcinogenic TNSAs through nitrosation16. However, little is known about the characteristics of this enzyme.

Amine oxidases play important roles in the metabolism of various organisms. The amine oxidases are an enormous group of enzymes that could show variations in their features, such as thermal stability and inhibitors17,18. Thus, we performed experiments to determine the specific features of Pnao. Pnao showed thermal stability below 50 °C, which is very unique among the enzymes involved in the nicotine degradation. Thus, we analyzed the sequence of pnao and the encoded protein, and found that a 58-amino acid fragment displayed a higher amount of Pro-Glu residues (27.6%) than other regions. Pro and Glu residues are very important for the structural stability of proteins at high temperature19. Sixteen residues (Pro or Glu) in this region were changed to Ser or Gly by site-directed mutagenesis, and the mutant proteins were not stable at high temperatures. In fact, one mutant, Pro180Ser, became extremely unstable at high temperature. The absorbance of the α-helices and β-folds started to change at temperatures above 25 °C, which was very different from that observed with the wild-type protein. However, Pro180Ser was still activated and the specific enzyme activity of Pro180Ser did not decrease significantly. Thus, we predict that residue 180 is extremely important for maintaining structural stability in different thermal environments as changing this amino acid had no evident effects on the enzyme activity.

In this study, approximately 0.3 mol of FAD/mol of wild-type Pnao was obtained, which was lower than the 0.5 mol/mol of enzyme reported previously20,21. Furthermore, there was no evident loss or increase of FAD regardless of the severity of the mutation (Fig. 3B). Enzyme activity did not increase in the presence of excess FAD, suggesting that the enzyme without FAD is unable to capture FAD. When the excessive FAD was added into the culture, the FAD amount didn’t increase. These observations suggest that this uncommon FAD to enzyme ratio is not due to insufficient FAD synthesis. In pH assays, W, Mo, and Fe were proved to be functional to Pnao. Thus 1 mM W, Mo, and Fe were added into the culture, respectively; however, there was no increase or loss of the FAD content (Fig. 3B). In this case, we infer that W, Mo, and Fe do not work by affecting the content of FAD.

Some mechanistic studies of amine oxidases, which produce NH4+, described a model in which the substrate was oxidized by O2 to form H2O2 and a carbon-nitrogen double bond, which was subsequently hydrolyzed22. When we added PN to a solution containing 15 mg/mL Pnao, the yellow solution turned colorless very quickly, and then returned to yellow after all the PN was degraded. When we performed the same assay in an anaerobic environment, the solution still turned colorless; however, it never returned to yellow, which suggests that O2, and not PN, is involved into the oxidation of FADH2. In addition, we inferred that FAD was reduced first, which then activated PN to form an intermediate.

Based on our results, we believe that PN is activated via FAD reduction and that a carbon-nitrogen double bond is formed in the first step. In the next step, H2O binds to the carbon-nitrogen double bond, and a hypothetical, extremely unstable intermediate is generated. This intermediate is quickly transformed to SAP and CH3NH2. At last, FAD is regenerated via oxidation for the next round of catalysis (Fig. 4D).

In summary, we determined the role of H2O and O2 in the conversion of PN to SAP by Pnao and inferred the mechanism of Pnao, showing unique features, such as unsaturated FAD content, and thermal stability that is related to site-directed mutagenesis with which residue 180 is important for thermal stability. In addition, Pnao shows significant increase of enzyme activity in presence of tungstate, which is rarely found in the literature.

Methods

Materials

l-(–)-Nicotine (≥99% purity) was gained from Fluka Chemie GmbH (Buchs Corp., Buchs, Switzerland). Flavin adenine dinucleotide (FAD) was obtained from Sigma-Aldrich (St. Louis, MO, USA). 18O2 and H218O were from Shanghai Research Institute of Chemical Industry. PN (98%) and 3-succinoylsemialdehyde-pyridine (SAP) were from Toronto Research Chemicals (Canada). All other reagents and solvents applied in this study were analytical grade and easily available.

Bacterial strains, plasmids and culture conditions

The bacterial strains, vectors, and recombinant plasmids applied in this study are listed in Table 1. P. putida S16 and their derivatives were cultured at 30 °C in Lysogeny broth (LB) medium containing 1 g L–1 nicotine. E. coli strains were grown at 37 °C in LB medium. Kanamycin and ampicillin were used for selection at appropriate concentrations.

Table 1. Bacterial strains and plasmids used in this study.

Bacterial strain or plasmids Characteristics
Pseudomonas putida S16 Apr; wild type; nicotine degrader; G
Escherichia coli strains
 DH5α F recA1 endA1 thi-1 supE44 relA1 deoR△(lacZYA-argF)U169 φ80lacZ△M15
 BL21(DE3) F ompT hsdS(rB mB) gal dcm lacY1(DE3)
 C43(DE3) F ompT hsdSB (rB mB) gal dcm (DE3)
Plasmids
 pET28a(+) Kmr; expression vector
 pET-pnao Kmr; NcoI-XhoI fragment containing pnao
 pET-pnaoE131G Kmr; NcoI-XhoI fragment containing pnaoE131G
 pET-pnaoE159G Kmr; NcoI-XhoI fragment containing pnaoE159G
 pET-pnaoE162G Kmr; NcoI-XhoI fragment containing pnaoE162G
 pET-pnaoE174G Kmr; NcoI-XhoI fragment containing pnaoE174G
 pET-pnaoP141S Kmr; NcoI-XhoI fragment containing pnaoP141S
 pET-pnaoP156S Kmr; NcoI-XhoI fragment containing pnaoP156S
 pET-pnaoP180S Kmr; NcoI-XhoI fragment containing pnaoP180S

Expression and purification of His6-Pnao in vitro

The full-length DNA fragment of pnao was amplified by PCR (primers pnaoEF-NcoI/ pnaoEF-XhoI), and inserted into the NcoI-XhoI sites of the expression vector pET28a to reconstruct pET28a-pnao. Plasmid pET28a-pnao was transferred into E. coli C43(DE3) for heterologous expression. E. coli C43(DE3) with the reconstructed plasmids were cultured in LB containing 100 mg l−1 ampicillin, at 37 °C to an optical density at 600nm 0.8 to 1. Isopropyl-β-D-thiogalactopyranoside (IPTG) (200 μmol) was subsequently added to induce the culture at 16 °C for 20 h to 24 h. The harvested cells were re-suspended with 20 mM Tris-HCl (pH 7.5) buffer and disrupted by sonication in an ice-water bath. Cell debris and insoluble proteins were removed by centrifugation (12,000 × g for 30 min). The crude enzyme was loaded onto a His-bind resin. The His6-tagged Pnao was eluted by 200 mM imidazole after elution of the no target proteins with 20 and 50 mM imidazole. The eluted sample was loaded onto a Superdex 200 column which had been pre-equilibrated with 10 mM Tris-HCl (pH 7.5) buffer. The protein concentration was quantified by the Bradford method using bovine serum albumin as the standard. All those steps were performed at 4 °C and the collected His6-tagged protein Pnao was preserved at −70 °C for further study.

Determination of the Pnao cofactor

The purified Pnao was boiled for 5 min to release the cofactor and precipitate the protein. The solution was filtered by 0.22 μm membrane after centrifugation. The filtered supernatant was detected by high-performance liquid chromatography (HPLC) (Agilent 1200 series, Hewlett-Packard Corp., Santa Clara, CA, U.S.A.) with a C-18 column (4.6 by 250 nm; 5 μm). The mobile phase was 10 mM ammonium acetate containing 30% methanol (v v−1). The flow rate was 0.5 mL min–1. The contents were monitored by determining the absorbance at 265 nm. The standard curve was drawn in the range of 0 to 0.3 mM to analyze the concentration of FAD.

Biochemical analysis of Pnao

Buffer, Pnao and PN were all freeze-dried in advance. In the H218O assay, powdered buffer, PN and Pnao were added into 500 μL H218O, and the whole system was incubated at 45 °C for 1.5 h. The 18O2 labeling reaction and anaerobic assay were performed in a rubber sealed bottle attached to an anaerobic workstation (AW200SG, Electrotek Ltd, UK). All the liquid was exposed in N2 atmosphere for 1 h to remove the O2. The mixture of buffer, powdered PN and Pnao was transferred into a tube filled with 18O2 and sealed again. The reaction was performed in room temperature for 4 h.

Enzymatic reaction in vitro

The Pnao activity was determined by measuring the formation of SAP on UV-2550 spectrophotometer (Shimadzu, Kyoto, Japan). SAP showed an absorption peak at 230 nm which can be measured by UV-2550 spectrophotometer. The activity could also be quantified based on the peak area of PN on HPLC. The common reaction mixture contained 2 mM PN, and 25 mM NaH2PO4-Na2HPO4 (pH 8.5) in a final volume of 0.5 mL. The reaction was started after the addition of Pnao (50 μg), and the machine would detect the slope within 30 s at 230 nm. The reaction was started after the addition of Pnao (50 μg), and ended by 1 M H2SO4 (10 μL) at 60 s.

Buffers from pH 5.0–7.5 (citric acid/sodium citrate), 7.5–8.5 (Tris-HCl), 8.5–9.0 (monosodium orthophosphate/disodium hydrogen phosphate) and 9.0–10 (sodium carbonate/sodium hydrogen carbonate) were used. The protein was incubated in buffers overnight at 25 °C for the stability assay.

In metal salt assay, NaCl, NiCl2, BaCl2, CoCl2, CaCl2, CuCl2, MnCl2, ZnCl2, KCl, Na2MoO4, Na2WO4, CdCl2, BdCl2, FeCl3 and MgCl2 were used to prepare the 2 mM metal solution. The protein was incubated in 2 mM metal solution overnight at 25 °C for the stability assay.

Electrophoresis of Pnao

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using a 12% gel in a MiniProtean III electrophoresis cell (Bio-Rad, Hemel Hempstead Corp., UK). The native page assay (Native-PAGE) was performed using a 7–12% gel in the ice-bath.

Detection of tungsten in Pnao

Pnao was added into 30% nitrite acid solution to 10 mL and incubated at 100 °C for 1 h. The product was detected on inductively coupled plasma-atomic (optical) emission spectrometry (ICP-OES, iCAP 6000 Radial, Thermo, America).

Site-directed mutagenesis of Pnao

The site-directed mutagenesis was performed by pEASY-Uni Seamless Cloning and Assembly Kit (TransGen, China). The primers are listed in Table 2. The mutants of pnao genes were inserted into pET28a and transferred into E. coli C43(DE3). The specific enzyme activity was detected by adding excessive FAD at 230 nm. The concentration of FAD which attached to the protein was determined by HPLC as previously described.

Table 2. Primers.

Primers Sequence (5′–3′)
Wildtype Pnao F: ATACCATGGTGACAAAAGATGGTGATGAAGGCAGC
R: GTGCTCGAGCGCATTGTCATTTTCTCTTTTTAG
PnaoE131G F:ATGCACTATGGCCTAGGGGTGGAGGAGACGGT
R:ACCGTCTCCTCCACCCCTAGGCCATAGTGCAT
PnaoE159G F: GAGCACCTGCAGCAGGGGCGTTTGAAATTTT
R: AAAATTTCAAACGCCCCTGCTGCAGGTGCTC
PnaoE162G F: CAGCAGAGGCGTTTGGAATTTTTGGCTCTGC
R: GCAGAGCCAAAAATTCCAAACGCCTCTGCTG
PnaoE174G F: ACGAATACTACAAAGGAGCACGGAATATTTA
R: TAAATATTCCGTGCTCCTTTGTAGTATTCG
PnaoP149S F: GTCGGTCTTGCGAATTCAGAGACCGTCATTT
R: AAATGACGGTCTCTGAATTCGCAAGACCGAC
PnaoP156S F: AATGTCAAAAGAGCATCTGCAGCAGAGGCGT
R: ACGCCTCTGCTGCAGATGCTCTTTTGACATT
PnaoP180S F: GCACGGAATATTTATTCGCGCCCGTTTGAAC
R: GTTCAAACGGGCGCGAATAAATATTCCGTGC

Analytical techniques

PN and SAP were detected by HPLC, and the mobile phase of HPLC was a mixture of 10% methanol and 90% 1 mM H2SO4. The flow rate was 0.6 mL min–1, and the column (C-18, 4.6 × 250 mm) was at 30 °C. The products of enzymatic reaction were performed on an Agilent 6230 time of flight-MS equipped with ESI sources using C18 column (4.6 by 150 nm, 5 μm). The mobile phase was an acetonitrile-H2O (0.01% HCOOH [v v–1]; flow rate 0.4 mL min–1). The column temperature was at 30 °C. The samples were ionized by electrospray with a positive polarity. PN and SAP could be easily detected with thin layer chromatography (TLC). The mobile phase consists of chloroform, methanol, ethanol and H2O (12 : 0.8 : 6 : 0.6; [vol/vol/vol/vol]).

Additional Information

How to cite this article: Hu, H. et al. Characterization of Pseudooxynicotine Amine Oxidase of Pseudomonas putida S16 that Is Crucial for Nicotine Degradation. Sci. Rep. 5, 17770; doi: 10.1038/srep17770 (2015).

Supplementary Material

Supplementary Information
srep17770-s1.doc (1.1MB, doc)

Acknowledgments

This work was supported in part by grants from the Chinese National Science Foundation for Excellent Young Scholars (31422004). This work was supported in part by grants from the Chinese National Natural Science Foundation (31230002). We also acknowledge the “Shanghai Rising-Star Program” (13QA1401700) and the “Chen Xing” project from Shanghai Jiaotong University.

Footnotes

Author Contributions P.X. and H.T. conceived and designed the project and experiments. H.H. and W.W. performed the experiments. H.H. and H.T. wrote the paper. H.H., W.W., P.X. and H.T. reviewed the manuscript. All authors reviewed the paper.

References

  1. Johnson J. D. et al. Effects of mainstream and environmental tobacco smoke on the immune system in animals and humans. Crit. Rev. Toxicol. 20, 369–395 (1990). [DOI] [PubMed] [Google Scholar]
  2. Campain J. A. Nicotine: potentially a multifunctional carcinogen? Toxicol. Sci. 79, 1–3 (2004). [DOI] [PubMed] [Google Scholar]
  3. Heusch W. L. & Maneckjee R. Signalling pathways involved in nicotine regulation of apoptosis of human lung cancer cells. Carcinogenesis 19, 551–556 (1998). [DOI] [PubMed] [Google Scholar]
  4. Tricker A. R. et al. N-Nitroso compounds in cigarette tobacco and their occurrence in mainstream tobacco smoke. Carcinogenesis 12, 257–261 (1991). [DOI] [PubMed] [Google Scholar]
  5. Hoffmann D. & Hecht S. S. Nicotine-derived N-nitrosamines and tobacco-related cancer: current status and future directions. Cancer Res. 45, 935–944 (1985). [PubMed] [Google Scholar]
  6. Preston-Martin S. Evaluation of the evidence that tobacco-specific nitrosamines (TSNA) cause cancer in humans. Crit. Rev. Toxicol. 21, 295–298 (1991). [DOI] [PubMed] [Google Scholar]
  7. Hecht S. S. Biochemistry, biology, and carcinogenicity of tobacco-specific N-nitrosammes. Chem. Res. Toxicol. 11, 559–603 (1998). [DOI] [PubMed] [Google Scholar]
  8. Morse M. A. et al. Inhibition of 4-(methylnitrosamino)-l-(3-pyridyl)-l-butanone-induced DNA adduct formation and tumorigenicity in the lung of F344 rats by dietary phenethyl isothiocyanate. Cancer Res. 49, 549–553 (1989). [PubMed] [Google Scholar]
  9. Hecht S. S. et al. Comparative tumorigenicity and DNA methylation in F344 rats by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone and N-nitrosodimethylamine. Cancer Res. 46, 498–502 (1986). [PubMed] [Google Scholar]
  10. Tang H. et al. Novel nicotine oxidoreductase-encoding gene involved in nicotine degradation by Pseudomonas putida strain S16. Appl. Environ. Microbiol. 75, 772–778 (2009) [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Tang H. et al. A novel gene, encoding 6-hydroxy-3-succinoylpyridine hydroxylase, involved in nicotine degradation by Pseudomonas putida strain S16. Appl. Environ. Microbiol. 74, 1567–1574 (2008). [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Wang S. N. et al. Characterization of environmentally friendly nicotine degradation by Pseudomonas putida biotype A strain S16. Microbiology 153, 1556–1565 (2007) [DOI] [PubMed] [Google Scholar]
  13. Wang S. N. et al. “Green” route to 6-hydroxy-3-succinoyl-pyridine from (S)-nicotine of tobacco waste by whole cells of a Pseudomonas sp. Environ. Sci. Technol. 39, 6877–6880 (2005). [DOI] [PubMed] [Google Scholar]
  14. Qiu J. et al. Functional identification of two novel genes from Pseudomonas sp. strain HZN6 involved in the catabolism of nicotine. Appl. Environ. Microbiol. 78, 2154–2160 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Tang H. et al. Systematic unraveling of the unsolved pathway of nicotine degradation in Pseudomonas. PLoS Genet. 9, e100392 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lewis R. S. et al. Impact of alleles at the Yellow Burley (Yb) loci and nitrogen fertilization rate on nitrogen utilization efficiency and tobacco-specific nitrosamine (TSNA) formation in air-cured tobacco. J. Agric. Food Chem. 60, 6454–6461 (2012). [DOI] [PubMed] [Google Scholar]
  17. Sugawara A. et al. Characterization of two amine oxidases from Aspergillus carbonarius AIU 205. J. Biosci. Bioeng. 119, 629–635 (2015). [DOI] [PubMed] [Google Scholar]
  18. Shepard E. M. & Dooley D. M. Inhibition and oxygen activation in copper amine oxidases. Acc. Chem. Res. 48, 1218–1226 (2015). [DOI] [PubMed] [Google Scholar]
  19. Haney P. J. et al. Thermal adaptation analyzed by comparison of protein sequences from mesophilic and extremely thermophilic Methanococcus species. Proc. Natl. Acad. Sci. USA. 96, 3578–3583 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Schryvers A. et al. Chemical and functional properties of the native and reconstituted forms of the membran-bound, aerobic glycerol-3-phosphate dehydrogenase of Escherichia coli. J. Biol. Chem. 253, 783–788 (1978). [PubMed] [Google Scholar]
  21. Dailey H. A. & Dailey T. A. Protoporphyrinogen oxidase of Myxococcus xanthus. Expression, purification, and characterization of the cloned enzyme. J. Biol. Chem. 271, 8714–8718 (1996). [DOI] [PubMed] [Google Scholar]
  22. Fitzpatrick P. F. Combining solvent isotope effects with substrate isotope effects in mechanistic studies of alcohol and amine oxidation by enzymes. Biochim. Biophys. Acta. in press, 10.1016/j.bbapap.2014.10.020 (2014). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Information
srep17770-s1.doc (1.1MB, doc)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES