Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Name | Primer | Product Size (bp) |
|---|---|---|
| AQP5 Promotor -0.6kb-F | ggaggaaaaggaggagct | 600 |
| AQP5 Promotor -0.6kb-R | ggtggccgcgggggcccgg | |
| AQP5 Promotor -1.2kb-F | caaaaagagaaatagggttttg | 1200 |
| AQP5 Promotor -1.2kb-R | ggtggccgcgggggcccgg | |
| AQP5 Promotor -2.4kb-F | agtcccaggcccagaagaaaat | 2400 |
| AQP5 Promotor -2.4kb-R | ggtggccgcgggggcccgg |
