Table 1.
Forward primer | LCRed-640 | 6-FAM | Reverse primer | |
---|---|---|---|---|
T AGTGACAAGAAATAACAATACGGGGC- -TT | GTCTTGTAATTGGAATGATGGGAATT | AAACCTCTTCCAGAGTATCAATTGG | AGTTAAAAAGCTCGTAGTTGAATTTCTGCTG | |
T. orientalis | ...........................- -.. | .......................... | ......................... | ............................... |
T. buffeli | ...........................- -.C | .......................... | ......................... | ............................... |
T. annulata | ........................... - - .. | .......................... | ......................... | ............................... |
T. sergenti | ........................... - - .. | .......................... | ......................... | ............................... |
T. luwenshuni | ........................... - - .. | .......................... | ......................... | ............................... |
T. velifera | ........................... - - .. | .C........................ | ......................... | ..............................A |
T. ovis | ........................... - - .. | .......................... | ......................... | ............................... |
T. parva | ........................... - - .. | .......................... | ......................... | ............................... |
T. uilenbergi | ........................... - - .. | .......................... | ......................... | .............................C. |
T. lestoquardi | ........................... - - .. | .......................... | ......................... | ............................... |
T. equi | ......................A.... - - .. | .......................... | .....C................... | ............................... |
T. separata | ........................... - - .. | .......................... | ......................... | ......................C........ |
T. capreoli | ........................... - - .. | .......................... | ......................... | ............................... |
T. bicornis | ........................... - - .. | .....C.................... | ......................... | ............................... |
T. taurotragi | ........................... - - .. | .......................... | ......................... | ............................... |
T. mutans | ........................... - - .C | .C.......................C | .....C................... | ............................... |
Theileria sp. OT3 | ........................... - - .. | .......................... | ......................... | ............................... |
Theileria sp. NG | ........................... - - .. | .......................... | ......................... | ............................... |
Theileria sp. YW | ........................... - - .. | .......................... | ......................... | ............................... |
Theileria sp. B15 | ........................... - - .C | .C......................CC | .....C................... | .............................C. |
B. vulpes | ......................A.... - - .. | .........................C | .....CT.C................ | ......G......................CT |
B. hongkongensis | ......................A.... - - AA | .....................TG.C. | .....CTCA........G....... | ....................T....T...GT |
B. divergens | ......................A.... - - AA | .....................TG.CC | .....CTCA........A....... | .........................T...GT |
B. bovis | ...............C........... - - .A | .CTC.........C...GG..CG.CC | TC...CTCG..C.....C.C..... | ........................C.A-.GT |
B. bigemina | ......................A.... - - .. | .....................TG..G | .C.A.CTCA........C....... | ....G...............T.....A..CT |
B. gibsoni | ......................A.... - - AA | .....................TG.CG | ...ATCTCA........A....... | .A...........................GT |
B. microti | ......................A.... - - .. | .........................C | .....CT.C................ | ......G......................CT |
B. felis | ......................A.... - - .. | ......................G.CC | .....CT.C................ | ......G......................CT |
B. canis | ......................A.... - - .A | .....................TG.C. | .....CTCA........G....... | .........................TA..GT |
C. felis | .......................A... - - .. | ..................C..A.... | ..G.TCT....G............. | ............................... |
H. americanum | ......................AA...AA.. | .CT................A.A.... | ....ACT..TT.A............ | ............................T.A |
T. gondii | ...................C..T..AAAT.. | T...A..G...........A.....C | .....C...T.......A....... | ....................G.......... |
Primers and probes are shown at the head of the table. Dots indicate nucleotides identical to primers and probes, and dashes denote absence of the nucleotide. The upstream primer is used as the demonstrated sequences without gaps while the two probes and downstream primer are used as antisense oligonucleotides. The designed oligonucleotides show minimum mismatching with Theileria spp. The 6-FAM label is directly attached to the 3-terminal nucleotide of the fluorescein probe, and the LCRed-640 fluorescein label is added via a linker to the 5′-end of the LCRed-640 probe. The 18S rRNA sequences for the available recognized Theileria spp. on GenBank and other closely related protozoan species were obtained from GenBank: T. orientalis (HM538222), T. buffeli (HQ840967), T. annulata (KF429799), T. sergenti (EU083804), T. luwenshuni (JX469527), T. velifera (AF097993), T. ovis (AY508458), T. parva (L02366), T. uilenbergi (JF719835), T. equi (AY534882), T. lestoquardi (JQ917458), T. separata (AY260175), T. capreoli (AY726011), T. bicornis (AF499604), T. taurotragi (L19082), T. mutans (FJ213585), Babesia vulpes (JX454779), Theileria sp. OT3 (KF470868), Theileria sp. NG-2013a (KF597076), Theileria sp. YW-2014 (AB981984), Theileria sp. B15a (JN572700); B. hongkongensis (JQ867356), B. divergens (AJ439713), B. bovis (JQ723013), B. bigemia (JQ723014), B. gibsoni (EU583386), B. microti (AB219802), B. felis (AF244912), B. canis (HM590440), Hepatozoon americanum (AF176836), Cytauxzoon felis (AY679105), and Toxoplasma gondii (L37415).