Abstract
Host control of influenza A virus (IAV) is associated with exuberant pulmonary inflammation characterized by the influx of myeloid cells and production of proinflammatory cytokines including interferons (IFNs). It is unclear, however, how the immune system clears the virus without causing lethal immunopathology. Here, we demonstrate that in addition to its known anti-viral activity, STAT1 signaling coordinates host inflammation during IAV infection in mice. This regulatory mechanism is dependent on both type I IFN and IFN-γ receptor signaling and, importantly, requires the functional interplay between the two pathways. The protective function of type I IFNs is associated with not only the recruitment of classical inflammatory Ly6Chi monocytes into IAV-infected lungs, but also the prevention of excessive monocyte activation by IFN-γ. Unexpectedly, type I IFNs preferentially regulate IFN-γ signaling in Ly6Clo rather than inflammatory Ly6Chi mononuclear cell populations. In the absence of type I IFN signaling, Ly6Clo monocytes/macrophages, become phenotypically and functionally more proinflammatory than Ly6Chi cells, revealing an unanticipated function of the Ly6Clo mononuclear cell subset in tissue inflammation. In addition, we show that type I IFNs employ distinct mechanisms to regulate monocyte and neutrophil trafficking. Type I IFN signaling is necessary, but not sufficient, for preventing neutrophil recruitment into the lungs of IAV-infected mice. Instead, the cooperation of type I IFNs and lymphocyte-produced IFN-γ is required to regulate the tissue neutrophilic response to IAV. Our study demonstrates that IFN interplay links innate and adaptive anti-viral immunity to orchestrate tissue inflammation and reveals an additional level of complexity for IFN-dependent regulatory mechanisms that function to prevent excessive immunopathology while preserving anti-microbial functions.
Author Summary
Influenza A virus (IAV) is a leading cause of respiratory infection and induces a strong acute inflammation manifested by the recruitment of monocytes and neutrophils as well as the production of proinflammatory cytokines in infected lungs. The interferons (IFNs) are strongly induced by IAV and are known to mediate host resistance to the infection. However, in contrast to their well-studied inhibitory effect on viral replication, the effects of IFNs on host inflammatory responses are less well understood. In this manuscript, we demonstrate that anti-viral IFN signaling is also required for the orchestration of a tissue response associated with the protection against IAV infection in mice. Importantly, we identify that type I IFNs cross-regulate and cooperate with IFN-γ to inhibit monocyte activation and neutrophil infiltration, respectively. This study also demonstrates that Ly6Clo monocytes/macrophages can potentially mediate influenza virus-induced inflammation, suggesting that IFNs dictate the homeostasis versus inflammatory function of mononuclear phagocytes in viral infection. Our study reveals a novel IFN-dependent regulatory mechanism designed to prevent the excessive immunopathology while preserving its anti-microbial functions. Moreover, these observations have particular relevance for understanding the mechanisms underlying the strong inflammatory response associated with lethal IAV strains and have implications for the development of new immunotherapies to treat influenza.
Introduction
Influenza A virus (IAV) is a leading cause of respiratory infection and an ongoing threat to global health. Host clearance of IAV, which infects primarily airway epithelial cells, requires the development of both innate and adaptive immune responses [1,2]. Interestingly, recent studies have suggested that the host immune response rather than the cytopathic effect of viral infection plays the key role in driving tissue pathology and host mortality [3–5].
IAV triggers an acute pulmonary inflammation associated with the recruitment of inflammatory monocytes and neutrophils in infected lungs (reviewed in [6]). While it is clear that elevated neutrophil accumulation into infected lungs is associated with increased mortality following IAV infection [7,8], monocyte recruitment can be host protective or detrimental [9,10], suggesting that monocytes may play a multifactorial role in the infection. The current understanding of monocytes suggests that there are at least two major subsets: classical Ly6Chi and nonclassical Ly6Clo monocytes [11]. The classical Ly6Chi monocytes are known to mediate various inflammatory conditions [12] and accumulate in large numbers in IAV-infected lungs [13]. In contrast, nonclassical Ly6Clo cells have been shown to “patrol” the vasculature to clear damaged endothelial cells and contribute to tissue remodeling during the resolution phase of inflammation [14]. Interestingly, the patrolling Ly6Clo monocytes have been shown to differentiate into alternatively activated macrophages during Listeria monocytogenes infection [14]. However, the phenotype and function of Ly6Clo monocytes / macrophages (Mo/Mϕ) in IAV infection are currently unknown.
In addition to recruiting myeloid cells, IAV induces the production of proinflammatory cytokines, including type I and II interferons (IFNs), in infected animals. The type I IFN family consists of ~20 different members believed to be important in anti-viral and cancer immunity [15], whereas the sole member of type II IFN, IFN-γ, plays a major role in activating Mo/Mϕ and protection against intracellular bacterial and parasitic infections (Reviewed in [16]). In contrast to its extensively studied function in initiating a cell-autonomous anti-viral state, the mechanisms by which IFN signaling regulates host tissue responses to IAV infection are poorly understood. Several recent studies have shown that viral-induced type I IFNs promote the accumulation of classical Ly6Chi monocytes into the airway and lungs of IAV-infected mice [17,18]. However, it is unclear whether these cytokines also regulate the function of pulmonary monocytes for the resistance to IAV infection. Moreover, the contribution of IFN-γ to IAV-induced pulmonary tissue inflammation is not clearly defined.
We report in this study that type I IFN and IFN-γ signaling each play a pleiotropic role in the pulmonary inflammatory response to IAV. Importantly, IFN cross-regulation and cooperation are essential for the suppression of monocyte- and neutrophil-driven tissue inflammation. While antagonizing IFN-γ signaling to inhibit Mo/Mϕ activation, type I IFNs synergize with IFN-γ to inhibit neutrophil infiltration. Moreover, we demonstrate that in the absence of type I IFN signaling, Ly6Clo Mo/Mϕ become more proinflammatory than their Ly6Chi counterparts. Since the Ly6Clo Mo/Mϕ population is traditionally associated with tissue remodelling rather than inflammation, our findings also reveal an unrecognized pro-inflammatory potential for Ly6Clo Mo/Mϕ and suggest that IFNs dictate the homeostasis versus inflammatory function of mononuclear cells in viral infection.
Results
STAT1 signaling controls pulmonary inflammatory response to IAV infection
Sub-lethal, intranasal (i.n.) infection with influenza A/Puerto Rico/8 (PR8) virus in wild-type (WT) mice is characterized by a progressive weight loss that peaks at day 10, after which mice recover and clear the infection (Fig 1A and [19]). To investigate the function of IFNs in shaping the host response to IAV infection, we first examined IFN gene expression and observed that while in WT mice type I IFNs Ifna and Ifnb were both rapidly up-regulated at day 3 post-infection (p.i.), the sole type II IFN, Ifng, was not significantly induced until day 7 p.i. (Fig 1B). The expression of both type I and II IFNs declined to baseline levels by day 10 p.i.. In WT mice, the cellular immune response to IAV infection was characterized by the strong influx of monocytes that peaked at day 7 and then declined by day 10, at which point T cells became the dominant immune cell subset in lungs (Fig 1C). In contrast to WT controls, Stat1-deficient mice, lacking both type I IFN and IFN-γ signaling, displayed a neutrophil-enriched cellular response (Fig 1D), highlighting the critical importance of IFN signaling in orchestrating a protective tissue response to IAV infection. Next, we quantified the viral loads at days 3 and 7 p.i. using both qRT-PCR and classical plaque forming (PFU) assays. While mRNA copy numbers of viral nucleoprotein (NP) determined by qRT-PCR were comparable in WT and Stat1 —/—mice, the latter animals showed a marginal increase (0.4 log) in PFUs at day 7 (Fig 1E). The extent of defect in viral control in Stat1 —/—mice observed is consistent with that reported previously [20,21], suggesting that the dysregulated tissue response in Stat1 —/—mice cannot be explained fully by increased viral loads.
To determine whether the altered pulmonary inflammation in infected Stat1 —/—mice stems from dysregulated myelopoiesis in bone marrow (BM) or cell trafficking in the periphery, or both, we analyzed hematopoietic cells in the BM of infected WT and Stat1 —/—mice by flow cytometry. The stem/progenitor cell populations are commonly defined as lineage-negative Sca1+cKit+ (CD117+) (LSK) cells [22,23]. However, since Sca1 expression is regulated by IFNs (S1 Fig and [22]), we omitted Sca1 staining in the analysis. We did not observe a significant difference in the percentage of lineage-negative CD117+ progenitor cells (Fig 1F), or mature BM-residing CD11b+Ly6G+Ly6Clo neutrophils and CD11b+Ly6G—Ly6Chi monocytes (Fig 1G) in infected WT and Stat1 —/—mice, suggesting that IFN signaling plays a minimal role in regulating central myelopoiesis in the BM during IAV infection.
Cell-intrinsic type I IFN signaling promotes the recruitment of inflammatory Ly6Chi monocytes into IAV-infected lungs
To determine the relative contribution of type I and II IFNs to monocyte recruitment in IAV infection, we analyzed monocyte populations in the lungs of infected WT, Ifnar1 —/—, Ifngr1 —/— and Stat1 —/—mice using flow cytometry. When compared to WT mice, Ifnar1 —/— and Stat1 —/—mice displayed a significant reduction in CD11b+Ly6Chi monocytes in the lungs at day 7 p.i. (Fig 2A, 2B and 2C). The difference is unlikely due to kinetic variations of the pulmonary response to IAV in IFN signaling-sufficient and deficient mice, as the significant influx of leukocytes into the infected lungs was not observed until day 7 p.i. in all groups (Fig 2B and 2C). In contrast to Ifnar1 —/—animals, monocyte recruitment in Ifngr1 —/—mice was largely unaffected, suggesting that type I IFN signaling alone is sufficient to trigger monocyte recruitment into infected lungs. We next determined whether type I IFNs act directly or indirectly on monocyte populations to regulate their trafficking to lungs. Lethally irradiated CD45.1+ WT recipient mice were reconstituted with equal numbers of CD45.1+ WT and CD45.2+ Ifnar1 —/—BM cells. After full reconstitution (8–10 wk), chimera mice were infected with IAV and the cellular response analyzed at day 7 p.i. (Fig 2D). We found that the defect in the recruitment of Ly6Chi inflammatory monocytes observed in Ifnar1 —/—mice was not restored in CD45.2+ Ifnar1 —/—cells in mixed Ifnar1 —/—and Ifnar1 +/+ BM chimeric mice (Fig 2E). As such, the ratio of Ly6Chi / Ly6Clo monocytes in the CD45.2+ Ifnar1 —/—compartment was significantly lower than that in the CD45.1+ Ifnar1 +/+ compartment, indicating that direct type I IFN signaling in Ly6Chi monocytes is required for their recruitment into infected lungs (Fig 2F).
Type I IFNs regulate the phenotype and function of pulmonary monocytes in IAV infection
We next examined whether type I IFN signaling regulates the phenotype and function of major populations of CD11b+ monocytes in IAV-infected lungs. Consistent with current knowledge of mononuclear phagocyte subsets [11], we observed that Ly6Chi monocytes in IAV-infected lungs displayed higher CCR2 expression than their Ly6Clo counterparts in WT and Ifnar1 —/—mice (Fig 3A). Furthermore, expression of the integrin LFA-1 (CD11a), a key molecule responsible for the function of monocytes [24], was unchanged on either Ly6Chi or Ly6Clo cells irrespective of type I IFN signaling. Strikingly, however, loss of type I IFN signaling on Ly6Clo but not Ly6Chi populations resulted in significant increases in the expression of MHC-II (I-A), CD11c, CD16/32 and CD64, suggesting that in Ifnar1 —/—mice, Ly6Clo Mo/Mϕ display a phenotype that is characteristic of activated proinflammatory monocytes. Consistent with this hypothesis, we found that Nos2, a known proinflammatory molecule produced predominantly by monocytes, was more highly expressed in the lungs of Ifnar1 —/—mice than WT animals (Fig 3B), despite the reduction in Ly6Chi monocytes in Ifnar1 —/—mice (Fig 2B).
Consistent with Nos2 gene analysis, flow cytometric analysis revealed that there was a significant increase in NOS2-expressing cells in the lungs of infected Ifnar1 —/—mice compared to WT animals (Fig 3C). Further analysis revealed that multiple mononuclear cells in IAV-infected lungs produced NOS2 (Fig 3D). However, while Ly6Chi monocytes were the major NOS2-producing cells in WT animals, both Ly6Chi and Ly6Clo subsets contributed to the NOS2 production in the lungs of infected Ifnar1 —/—mice (Fig 3D and 3E). Paired analysis of the two monocyte subsets among individual mice demonstrated that in Ifnar1 —/—animals, both the percentage of cells expressing NOS2 as well as the total quantity of NOS2 produced per cell was higher in Ly6Clo than Ly6Chi monocytes, suggesting that the former subset is more susceptible to type I IFN-dependent suppression (Fig 3F). Therefore, type I IFNs are able to regulate not only trafficking, but also the phenotype and effector function of mononuclear cells in the lung during IAV infection.
Type I IFNs suppress IFN-γ-dependent monocyte activation by down-regulating IFN-γ receptor
Since the surface markers and NOS2 examined above are known to be highly sensitive to induction by IFN-γ [25–27], we suspected that IFN-γ might play a role in the up-regulation of these molecules in the infected Ifnar1 —/—mice. Indeed, at day 3 p.i., a time point at which minimal levels of IFN-γ are produced (Fig 1B), there were no differences in the expression of I-A, CD11c or CD64 on Ly6Chi and Ly6Clo cells (S2 Fig). To demonstrate directly that IFN-γ is responsible for the up-regulation of the molecules, we compared the expression of I-A and NOS2 in Ly6Clo Mo/Mϕ of WT, Ifnar1 —/—, Ifngr1 —/—and Stat1 —/—mice at day 7 following IAV infection. We found that the enhanced expression of I-A and NOS2 observed in lungs of Ifnar1 —/—animals was completely abolished in Ifngr1 —/—mice as well as Stat1—/—mice that lack both type I IFN and IFN-γ signaling pathways (Fig 4A and 4B), suggesting that up-regulation of I-A and NOS2 in the absence of type I IFN signaling is driven by IFN-γ.
To determine whether type I IFNs act directly on monocytes to exert their suppressive effect, we analyzed NOS2 production in IAV-infected, mixed Ifnar1 +/+ and Ifnar1 —/—BM chimera mice and found that type I IFNs signal directly to suppress NOS2 production in both Ly6Clo (Fig 4C) and Ly6Chi (S3A Fig) mononuclear cells. Moreover, as we observed previously in Ifnar1 —/—mice (Fig 3F), Ly6Clo Mo/Mϕ in BM chimera mice expressed higher levels of NOS2 than their Ly6Chi counterparts (S3B Fig), confirming that enhanced susceptibility to type I IFN inhibition is intrinsic to this Mo/Mϕ subset. We next determined whether the enhanced IFN-γ-inducible response in IAV-infected Ifnar1 —/—mice was a consequence of increased IFN-γ production or signaling by examining the expression of Ifng and Ifngr1 in infected lungs. We found that although Ifng expression was comparable in the lungs of infected WT and Ifnar1 —/—mice, Ifngr1 levels were significantly higher in Ifnar1 —/—animals (Fig 4D), suggesting that enhanced IFN-γ signaling rather than IFN-γ production is responsible for the increased IFN-γ-inducible response in Ifnar1 —/—mice. To test this hypothesis, we analyzed the cell surface expression of IFN-γ receptor 1 (CD119) by flow cytometry and found CD119 expression was significantly increased on Ly6Clo Mo/Mϕ of Ifnar1 —/—mice compared to WT mice (Fig 4E and 4F). Therefore, the intrinsic regulation of IFN-γ receptor levels by type I IFNs appears to be a mechanism by which Mo/Mϕ activation is suppressed in the presence of type I IFNs.
Type I IFN signaling is necessary but not sufficient for the inhibition of neutrophil migration into the lungs of IAV-infected mice
Our findings above suggest that type I IFN signaling is dominant over IFN-γ in the recruitment of Ly6Chi monocytes to the lungs of IAV-infected mice (Fig 2). To investigate the relative contribution of type I and type II IFNs on the STAT1-dependent suppression of neutrophil migration (Fig 1D), WT, Ifnar1 —/—, Ifngr1 —/—and Stat1 —/—mice were infected with IAV and the relative abundance of neutrophils in each mouse strain determined by flow cytometry. Interestingly, we observed that both percentage and numbers of CD11b+Ly6G+ neutrophils were significantly elevated in the lungs of Ifnar1 —/—as well as Ifngr1 —/—mice compared to WT animals at day 7, but not day 3 p.i. (Fig 5A, 5B and 5C). Importantly, this defect was further exaggerated in Stat1 —/—mice, suggesting a synergistic function of type I and II IFNs in suppressing neutrophil recruitment during influenza infection. Moreover, in contrast to the cell-intrinsic function of type I IFNs in monocyte migration described above (Fig 2D), we found that the percentage of CD11b+Ly6CloLy6G+ neutrophils was comparable among CD45.1+ WT and CD45.2+ Ifnar1 —/—compartments before (S4 Fig) and following (Fig 5D) infection, suggesting that type I IFNs regulate neutrophil migration through a cell-extrinsic manner. Therefore, type I IFNs employ distinct mechanisms to regulate monocyte and neutrophil trafficking in IAV infection and act in concert with IFN-γ to prevent accumulation of tissue-damaging neutrophils at the site of infection. To investigate potential cell-extrinsic mechanisms responsible for the increased accumulation of neutrophils, we measured gene expression of the known neutrophil-attracting chemokine Cxcl1 and the cytokine Il1b in WT and IFN-signaling deficient animals. Stat1 —/—mice displayed significantly higher expression of Cxcl1 and Il1b than in either Ifnar1 —/—or Ifngr1 —/—mice (Fig 5E), consistent with the notion that IFNs synergize to suppress neutrophil chemotactic chemokine/cytokine production in IAV infection.
Adaptive IFN-γ and type I IFNs cooperate to inhibit neutrophil trafficking into lungs of IAV-infected mice
STAT1 is one of many transcription factors that can transduce both type I IFN and IFN-γ receptor signaling, but it can also mediate IFN-independent functions [28–30]. Therefore, it is possible that the increased neutrophilic influx in IAV-infected Stat1 —/—mice, as compared to Ifnar1 —/—mice, is independent of IFN-γ signaling. Moreover, it is unclear whether IFN-γ-dependent neutrophil suppression requires intact type I IFN signaling. Type I IFNs are known to regulate neutrophil recruitment by signaling directly in inflammatory monocytes to suppress their production of neutrophil chemoattracting chemokine Cxcl2 [31]. To address these questions, we generated Ifnar1 —/—BM reconstituted WT chimera mice, which are deficient in type I IFN signaling in hematopoietic cells only. Similar to Ifnar1 —/—mice, these chimeric mice also displayed defective pulmonary accumulation of Ly6Chi monocytes following IAV infection (S5 Fig). Ifnar1 —/—BM chimera mice treated with anti-IFN-γ antibody at day 2 and 6 p.i. exhibited a marked reduction in I-A expression on monocytes when analyzed at day 7 (Fig 6A). This is consistent with our previous observation that IFN-γ augments MHC class II expression (Fig 4) and confirms that the mAb administration successfully blocked IFN-γ activity. Importantly, consistent with the results presented in Fig 5, we found both the proportion and numbers of neutrophils to be significantly elevated in the anti-IFN-γ antibody-treated mice compared to untreated animals (Fig 6B). We also enumerated neutrophils in the bronchoalveolar lavage (BAL) and observed a similar increase in neutrophils in the airway of anti-IFN-γ antibody treated mice when compared to untreated controls (Fig 6C), indicating that IFN-γ regulates neutrophil migration into both the lung parenchyma and bronchoaveolar air spaces independent of type I IFN signaling in inflammatory monocytes. These results suggest that IFN-γ produced by the adaptive immune response to IAV infection regulates the tissue inflammatory response in addition to its anti-viral activity [1]. To test this hypothesis, we infected WT and Rag2 —/—mice, which lack B and T-cells, and analyzed the IFN-γ and neutrophil response at d7 p.i.. As expected, Rag2 —/—mice displayed significantly reduced IFN-γ expression (Fig 6D) and increased Ly6G+ neutrophil accumulation in the lungs when compared to WT animals (Fig 6E). Together, our findings reveal a mechanism by which IFNs link innate and adaptive immune systems to orchestrate pulmonary inflammation for the resistance to IAV infection.
Discussion
While it is established that IFN-mediated resistance to viral infection in vitro is dependent on the inhibition of viral replication [32], the mechanisms by which IFNs protect against infection in vivo are less well understood. Nevertheless, recent studies have suggested that type I IFN signaling is important in regulating myeloid cell migration during viral infections [17,31,33], arguing that IFNs can play a broader role in anti-viral immunity beyond their well-established cell-intrinsic anti-viral activity. In this study, we report that type I IFN signaling is necessary, but not sufficient, to control the full scale of pulmonary innate responses to IAV. To this end, the functional interplay between type I IFN and IFN-γ signaling pathways is required for the regulation of both monocyte- and neutrophil-driven pulmonary inflammation (Fig 6F). The discovery that, in the absence of type I IFN signaling, IFN-γ promotes inflammatory functions of Ly6Clo Mo/Mϕ suggests that the interplay between innate and adaptive IFNs dictates the outcome of tissue inflammation for the resistance to IAV infection.
The impaired Ly6Chi monocyte migration observed in infected Ifnar1 —/—mice bears similarities with Ccr2 —/—mice [10,18,34,35]. Indeed, the CCR2 ligands CCL2, CCL7 and CCL12 are all type I IFN-inducible and influence monocyte recruitment in a model of chronic inflammation [36]. A key difference between Ccr2 —/—and Ifnar1 —/—mice, however, is that CCR2 deficiency is favourable for infection outcome [10,18] whereas Ifnar1 —/—deficiency leads to enhanced mortality compared to WT animals [17]. Therefore, type I IFNs must mediate other protective mechanisms beside the recruitment of Ly6ChiCCR2+ inflammatory monocytes in IAV infection.
Unexpectedly, we discovered that type I IFN signaling plays a major role in suppressing mononuclear cell activation following IAV infection. Interestingly, this inhibition is particularly effective at suppressing the pro-inflammatory potential of Ly6Clo Mo/Mϕ. Our observation that Ifnar1 —/—Ly6Clo Mo/Mϕ express higher levels of CD11c, MHC class II and NOS2 than their Ly6Chi (WT or Ifnar1 —/—) counterparts is unexpected. These Ly6Clo cells resemble both phenotypically and functionally the inflammatory monocytes or TNF/iNOS-producing dendritic cells (Tip-DC) described in other inflammatory conditions (reviewed in [12]). Although Ly6Chi and Ly6Clo monocytes are considered to be phenotypically distinct lineages, and their developmental maturation is still under contention [37,38], our data demonstrate that both subsets can be activated by IFN-γ to mediate pro-inflammatory actions. Given these findings, it remains to be established whether CD11b+Ly6Clo Mo/Mϕ in lungs of IAV-infected mice represent a separate lineage or have developed from Ly6Chi monocytes as a result of the down-regulation of Ly6C expression upon entry into inflamed lung tissues as described in other models [33,36]. However, the latter scenario is unlikely to be the major mechanism accounting for Ly6Clo Mo/Mϕ accumulation in the absence of type I IFN signaling in our study, because of the significant difference in the numbers of total CD11b+ Mo/Mϕ in the lungs of infected WT and Ifnar1 —/—mice.
Our finding that type I IFNs differentially regulate neutrophil and monocyte trafficking in IAV infection is consistent with a previous report [17]. However, while the previous study analyzed exclusively the cells in the BAL, our investigation examined myeloid populations in both the BALF and lung tissues. Furthermore, in contrast to Seo et al, we did not observe any major changes in progenitor or mature myeloid cells in the BM and blood of IAV-infected Ifnar1 —/—or mixed BM chimeric mice, suggesting that the IFNs play a major role in coordinating regional immunity rather than central myelopoiesis as proposed by Seo and colleagues [17]. This discrepancy may be explained by the fact that the previous study analyzed myeloid progenitor populations following infection of BM with IAV in vitro, an event not typically known to occur during natural infection [39].
Importantly, in addition to defining the function of type I IFNs, we have uncovered two novel functions of IFN-γ in the pulmonary response to IAV infection; the inhibition of neutrophil migration and the induction of monocyte activation. Interestingly, although IFN-γ is known to elicit direct anti-viral activity in infected cells [16] and is produced in high quantities following influenza infection, its function in IAV infection has been elusive. Numerous studies investigating lymphocyte function, viral clearance or survival of mice deficient in IFN-γ or IFN-γR1 collectively reported no appreciable differences compared to WT animals [20,40–42]. Therefore the current study reveals a functional role for IFN-γ in influenza infection and suggests that some IFN-γ functions are masked by type I IFN-dependent regulatory mechanisms. The role of type III IFNs in pulmonary inflammation was not examined in this report, it is possible that the cytokines also play a role in controlling innate cell trafficking and activation during IAV infection. Indeed, a recent study revealed that type III IFNs can regulate neutrophil migration and function in an experimental arthritis model [43]. Interestingly, while type III IFNs are shown to mediate immunity to viral infections, there exists a large degree of redundancy with type I IFNs [44–46]. Future studies investigating the involvement of type III IFNs in this process may provide further insight into the regulatory functions of the IFN system.
Type I IFN production has previously been reported to suppress IFN-γ driven immune responses and resistance to intracellular bacteria [25,26], but it is unknown whether a similar mechanism is activated in viral infection. We demonstrate in this study that the IFN regulatory circuit also plays a pivotal role in the host response to IAV infection, particularly in preventing Ly6Clo Mo/Mϕ from IFN-γ-induced activation by regulating IFN-γR1 expression. The tightly controlled IFN-γ signaling in Ly6Clo Mo/Mϕ may explain why under some circumstance this monocyte population differentiates into alternatively activated macrophages [24], a process known to be susceptible to IFN-γ suppression [47]. Interestingly, the type I IFN cross-regulatory mechanism described here appears to function more actively in some components of the immune response to IAV infection than others, as the inhibitory effect of IFN-γ on neutrophil migration is not suppressed during IAV infection. Nevertheless, this and previous studies collectively suggest that inhibition of IFN-γ function by type I IFN signaling is an important regulatory mechanism operating under some infection and inflammatory settings, where both type I and II IFNs are produced [48]. We propose that in contrast to intracellular bacterial infection, where activation of infected monocytes by IFN-γ is essential for pathogen clearance, inhibition of IFN-γ by type I IFNs during influenza infection serves a host-protective role. Indeed, IFN-γ-inducible nitric oxide (NO) has been shown to play a major role in mediating pulmonary pathology in IAV infection [13,49–51] and, as such, must be tightly controlled to limit immune-mediated tissue damage.
IFNs are potently induced by viral pathogens and mediate host immunity to infections. In this study, we demonstrate the cooperation and cross-regulation between type I and II IFN signaling pathways coordinate a multifaceted pulmonary inflammatory response to IAV infection. Interestingly, it is known that viruses have evolved mechanisms to counteract the host IFN system [52]. Therefore, our findings suggest that in addition to impairing cell-intrinsic anti-viral effector functions as proposed previously [53], blockade of type I IFN production or signaling by viral products may lead to dysregulated inflammation, thereby contributing to impaired disease resistance and possibly increased viral transmission. This hypothesis may explain why some highly virulent strains of IAV are associated with hyper-inflammatory responses [54,55] and suggests that targeted manipulation of IFN signaling pathways could lead to new therapeutic opportunities.
Materials and Methods
Mice
C57Bl/6 (CD45.2+) and CD45.1+ (B6.SJL-Ptprca) mice were obtained from the Animal Resources Centre (ARC, Perth). Rag2 —/—, Ifnar1 —/—, Ifngr1 —/—and Stat1 —/—mice (all on C57Bl/6 background) were bred and maintained at the University of Sydney Bosch Rodent Facility.
Ethics statement
All mouse work was performed according to ethical guidelines as set out by the University of Sydney Animal Ethics Committee. All experiments within this manuscript were approved under protocol numbers 2013/5847 and 2013/5848. University of Sydney Animal Ethics Committee guidelines adhere to the Australian Code for the Care and Use of Animals for Scientific Purposes (2013) as set out by the National Health and Medical Research Council of Australia.
Influenza A virus infection
Mice were anaesthetized by intraperitoneal (i.p.) injection with 2% 2-2-tribromoethanol (Avertin) and inoculated intranasally (i.n.) with 20 plaque forming units (PFU) of influenza A virus strain PR8 (A/Puerto Rico/8/1934 H1N1) in a volume of 50 μl. PR8 virus was a kind gift from A/Professor John Stambas (Deakin University, VIC., Australia).
Influenza A virus plaque assays
IAV was quantified by plaque assays with MDCK cells using standard methods. In brief, 0.9 x 106 MDCK cells were seeded in each well of a 6-well culture plate. Lungs were homogenized in RPMI and clarified by centrifugation for 5 minutes at 2,000 g. Homogenates were serially diluted in RPMI and added to MDCK cell monolayers. After incubation for 45 minutes at 37°C, cells were overlaid with 1% w/v Avicel (FMC Biopolymer) in L15 media (Sigma Aldrich) containing 2 μg/ml TPCK-treated trypsin (Worthington Biochemicals) and incubated at 37°C, 5% CO2 for 3 days. Cells were subsequently washed, methanol fixed and stained with crystal violet before plaques were counted.
Cell isolation
Euthanized animals were perfused with 10 ml PBS and the lungs removed into 1 ml cold 2% FCS/RPMI. Single cell suspensions were made by dissociating the lungs with a scalpel blade and then incubated in 2% FCS/RPMI supplemented with 2 mg/ml of DNaseI (Sigma Aldrich) and Collagenase IV (Sigma Aldrich) for 30 minutes at 37°C. The digested lungs were then dissociated through a 70 μm cell strainer (Falcon) and red blood cells lysed with ACK lysis buffer (Life Technologies). Cells were counted using trypan blue exclusion.
For bone marrow cells, femurs and tibias were removed and cleaned of flesh before the bone marrow was flushed out with 2% FCS/RPMI. Cells were pelleted at 300 g for 5 minutes and resuspended in ACK lysis buffer (Life Technologies) for 1 minute to lyse red blood cells. Cells were washed and resuspended in 2% FCS/RPMI before being counted by trypan blue exclusion.
For BAL collection, a catheter attached to a 3-way stop cock and 5 ml syringe was inserted into the trachea and the lungs flushed with 5 x 1 ml of cold PBS supplemented with 2 mM EDTA. Cells were pelleted at 300 g for 5 minutes and the cells resuspended in 250 ul of 2% FCS/RPMI and stored at 4°C until used for flow cytometric analysis.
Generation of bone marrow chimeric mice
BM chimeras were generated by lethally irradiating CD45.1+ recipient mice with 10 Gy, followed by intravenous transfer of 2 x 106 BM cells from Ifnar1 —/—mice into the tail vain. For mixed BM chimeras, irradiated CD45.1+ recipient WT mice were reconstituted with a total of 2 x 106 BM cells from WT (CD45.1+) and Ifnar1 —/—(CD45.2+) mice at a ratio of 1:1. Mice received antibiotic-supplemented (Trimethoprim sulpha) drinking water for 3 weeks after irradiation. Mice were used at least 8 weeks after bone marrow reconstitution.
In vivo IFN-γ neutralization in BM chimera mice
For in vivo IFN-γ neutralization, mice received 500 μg of anti-IFN-γ monoclonal antibody XMG1.2 intravenously on days 2 and 6 post IAV infection. Anti-IFN-γ clone XMG1.2 hybridoma was expanded in 10% FCS/RPMI supplemented with Pen/Strep (Gibco) and affinity purified using protein G beads (GE Healthcare). Purified antibody was dialyzed into PBS and filter sterilized prior to injection into mice.
Flow cytometry
Lung (1 x 106), blood (200 ul whole blood) or BM (4 x 106) cells were stained according to standard procedures. Briefly, cells were incubated for 30 minutes with UV Live/Dead stain according to the manufacturer’s instructions (Life Technologies). Cells were stained with the following antibodies in FACS wash (2% FCS/PBS): CD4 (clone GK1.5), CD8 (53–6.7), B220 (RA3-6B2), I-A/I-E (M5-114.15.2), Ly6G (1A8), Ly6C (HK1.4), CD11b (M1/70), CD45.1 (A20), CD45.2 (104), NK1.1 (PK136), Siglec-F (E50-2440), CCR2 (475301), LFA-1 (M17/4), CD119 (2E2), CD11c (N418), CD16/32 (93), CD64 (X54-5/7.1), CD45 (30-F11), Lineage cocktail, CD117 (2B8), Sca1 (D7), CD48 (HM48-1), CD150 (Q38-480). The gating strategy used for identifying cell populations is shown in S6 Fig. Monocyte and macrophage populations were identified as CD4—CD8—B220—NK1.1—SiglecF—Ly6G—CD11b+ and then categorized into Ly6Chi and Ly6Clo populations based on Ly6C expression. Neutrophils were identified as CD4—CD8—B220—NK1.1—SiglecF—CD11b+Ly6G+.
For intracellular NOS2 staining, single cell suspensions were incubated at 37°C for 3 hours prior to staining with surface marker antibodies. Intracellular staining was carried out using the BD Cytofix/Cytoperm kit according to the manufacturer’s instructions (BD). Intracellular staining was performed using NOS2 antibody (clone CXNFT). All flow cytometry data acquisition was performed on a LSRII using FACSDiva software (BD Biosciences) and all analysis was performed using FlowJo X v0.7 (TreeStar).
Tissue mRNA preparation and qRT-PCR
Following perfusion, mouse lung tissue was collected and submerged in RNAlater (Ambion) for 24 hours prior to long term storage at -80°C. RNA was prepared from mouse lungs using Trisure (Bioline) according to the manufacturer’s instructions (Bioline). Total RNA (2 μg) was reverse transcribed using the Tetro cDNA synthesis Kit with random primers according to the manufacturer’s instructions (Bioline). Data are expressed as fold increases over uninfected controls and were calculated by the ΔΔCT method using 18S as the reference gene.
For absolute viral nucleoprotein quantification, RNA was extracted from 1 x 107 PFU PR8 using the ISOLATEII RNA kit according to the manufacturer’s instructions (Bioline) and 100 ng reverse-transcribed with the Tetro cDNA synthesis kit using IAV nucleoprotein specific primers [39]. Following amplification, the 216 bp cDNA product was gel purified using a Gel Extraction kit (Sigma Aldrich) and total copy number determined based on size and yield of product. A standard curve was generated to determine absolute viral nucleoprotein mRNA copy number among sample mRNA.
All quantitative reverse-transcriptase PCR (qRT-PCR) was performed using SYBR NoROX master mix (Bioline) on a Roche LightCycler480. Forward and reverse qRT-PCR primers are listed in Table 1.
Table 1. List of qRT-PCR primer sequences.
Gene | Forward (5’) | Reverse (3’) |
---|---|---|
18S | GTAACCCGTTGAACCCCATT | CCATCCAATCGGTAGTAGCG |
Cxcl1 | TGTCAGTGCCTGCAGACCAT | CCTCGCGACCATTCTTGAGT |
Il1b | CAACCAACAAGTGATATTCTCCATG | GATCCACACTCTCCAGCTGCA |
Ifna | TGCAACCCTCCTAGACTCATT | CCAGCAGGGCGTCTTCCT |
Ifnb | ATGAGTGGTGGTTGCAGGC | TGACCTTTCAAATGCAGTAGA |
Ifng | ACAATGAACGCTACACACTGCAT | TGGCAGTAACAGCCAGAAACA |
Ifngr1 | TCAAAAGAGTTCCTTATGTGCCTA | TACGAGGACGGAGAGCTGTT |
IAV NP | CAGCCTAATCAGACCAAATG | TACCTGCTTCTCAGTTCAAG |
Nos2 | CAGCTGGGCTGTACAAACCTT | CATTGGAAGTGAAGCGTTTCG |
Statistics
All statistical analyses were performed in Prism 6 (GraphPad Software). Significance was determined using Student’s t-test when comparing two experimental groups or one-way ANOVA followed by Tukey’s post-test correction for more than two groups. Results with p<0.05 were deemed statistically significant. *<0.05, **<0.01, ***<0.001, ****<0.0001.
Supporting Information
Acknowledgments
We would like to thank Angel Pang for technical assistance, A/Prof. John Stambas for providing IAV and Drs. Andrew Mitchell and Frederic Sierro for critical reading of the manuscript.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was supported by a National Health and Medical Research Council (NHMRC) of Australia Project Grant (APP1051742). WJB is supported by a NHMRC Centre for Research Excellence in Tuberculosis Control grant (APP1043225). NB is supported by an Australian Postgraduate Award. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Braciale TJ, Sun J, Kim TS (2012) Regulating the adaptive immune response to respiratory virus infection. Nat Rev Immunol 12: 295–305. 10.1038/nri3166 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Iwasaki A, Pillai PS (2014) Innate immunity to influenza virus infection. Nat Rev Immunol 14: 315–328. 10.1038/nri3665 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Kobasa D, Jones SM, Shinya K, Kash JC, Copps J, et al. (2007) Aberrant innate immune response in lethal infection of macaques with the 1918 influenza virus. Nature 445: 319–323. [DOI] [PubMed] [Google Scholar]
- 4. Kash JC, Basler CF, Garcia-Sastre A, Carter V, Billharz R, et al. (2004) Global host immune response: pathogenesis and transcriptional profiling of type A influenza viruses expressing the hemagglutinin and neuraminidase genes from the 1918 pandemic virus. J Virol 78: 9499–9511. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Kash JC, Tumpey TM, Proll SC, Carter V, Perwitasari O, et al. (2006) Genomic analysis of increased host immune and cell death responses induced by 1918 influenza virus. Nature 443: 578–581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. La Gruta NL, Kedzierska K, Stambas J, Doherty PC (2007) A question of self-preservation: immunopathology in influenza virus infection. Immunol Cell Biol 85: 85–92. [DOI] [PubMed] [Google Scholar]
- 7. Brandes M, Klauschen F, Kuchen S, Germain RN (2013) A systems analysis identifies a feedforward inflammatory circuit leading to lethal influenza infection. Cell 154: 197–212. 10.1016/j.cell.2013.06.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Narasaraju T, Yang E, Samy RP, Ng HH, Poh WP, et al. (2011) Excessive neutrophils and neutrophil extracellular traps contribute to acute lung injury of influenza pneumonitis. Am J Pathol 179: 199–210. 10.1016/j.ajpath.2011.03.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Narasaraju T, Ng HH, Phoon MC, Chow VT (2010) MCP-1 antibody treatment enhances damage and impedes repair of the alveolar epithelium in influenza pneumonitis. Am J Respir Cell Mol Biol 42: 732–743. 10.1165/rcmb.2008-0423OC [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Lin KL, Suzuki Y, Nakano H, Ramsburg E, Gunn MD (2008) CCR2+ monocyte-derived dendritic cells and exudate macrophages produce influenza-induced pulmonary immune pathology and mortality. J Immunol 180: 2562–2572. [DOI] [PubMed] [Google Scholar]
- 11. Geissmann F, Manz MG, Jung S, Sieweke MH, Merad M, et al. (2010) Development of monocytes, macrophages, and dendritic cells. Science 327: 656–661. 10.1126/science.1178331 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Shi C, Pamer EG (2011) Monocyte recruitment during infection and inflammation. Nat Rev Immunol 11: 762–774. 10.1038/nri3070 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Aldridge JR Jr., Moseley CE, Boltz DA, Negovetich NJ, Reynolds C, et al. (2009) TNF/iNOS-producing dendritic cells are the necessary evil of lethal influenza virus infection. Proc Natl Acad Sci U S A 106: 5306–5311. 10.1073/pnas.0900655106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Auffray C, Sieweke MH, Geissmann F (2009) Blood monocytes: development, heterogeneity, and relationship with dendritic cells. Annu Rev Immunol 27: 669–692. 10.1146/annurev.immunol.021908.132557 [DOI] [PubMed] [Google Scholar]
- 15. Pestka S (2007) The interferons: 50 years after their discovery, there is much more to learn. J Biol Chem 282: 20047–20051. [DOI] [PubMed] [Google Scholar]
- 16. Schroder K, Hertzog PJ, Ravasi T, Hume DA (2004) Interferon-gamma: an overview of signals, mechanisms and functions. Journal of leukocyte biology 75: 163–189. [DOI] [PubMed] [Google Scholar]
- 17. Seo SU, Kwon HJ, Ko HJ, Byun YH, Seong BL, et al. (2011) Type I interferon signaling regulates Ly6C(hi) monocytes and neutrophils during acute viral pneumonia in mice. PLoS Pathog 7: e1001304 10.1371/journal.ppat.1001304 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Lin SJ, Lo M, Kuo RL, Shih SR, Ojcius DM, et al. (2014) The pathological effects of CCR2+ inflammatory monocytes are amplified by an IFNAR1-triggered chemokine feedback loop in highly pathogenic influenza infection. J Biomed Sci 21: 99 10.1186/s12929-014-0099-6 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Marois I, Cloutier A, Garneau E, Richter MV (2012) Initial infectious dose dictates the innate, adaptive, and memory responses to influenza in the respiratory tract. J Leukoc Biol 92: 107–121. 10.1189/jlb.1011490 [DOI] [PubMed] [Google Scholar]
- 20. Garcia-Sastre A, Durbin RK, Zheng H, Palese P, Gertner R, et al. (1998) The role of interferon in influenza virus tissue tropism. J Virol 72: 8550–8558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Durbin JE, Fernandez-Sesma A, Lee CK, Rao TD, Frey AB, et al. (2000) Type I IFN modulates innate and specific antiviral immunity. J Immunol 164: 4220–4228. [DOI] [PubMed] [Google Scholar]
- 22. Essers MAG, Offner S, Blanco-Bose WE, Waibler Z, Kalinke U, et al. (2009) IFN alpha activates dormant haematopoietic stem cells in vivo. Nature 458: 904–U911. 10.1038/nature07815 [DOI] [PubMed] [Google Scholar]
- 23. Oguro H, Ding L, Morrison SJ (2013) SLAM family markers resolve functionally distinct subpopulations of hematopoietic stem cells and multipotent progenitors. Cell Stem Cell 13: 102–116. 10.1016/j.stem.2013.05.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Auffray C, Fogg D, Garfa M, Elain G, Join-Lambert O, et al. (2007) Monitoring of blood vessels and tissues by a population of monocytes with patrolling behavior. Science 317: 666–670. [DOI] [PubMed] [Google Scholar]
- 25. Antonelli LR, Gigliotti Rothfuchs A, Goncalves R, Roffe E, Cheever AW, et al. (2010) Intranasal Poly-IC treatment exacerbates tuberculosis in mice through the pulmonary recruitment of a pathogen-permissive monocyte/macrophage population. J Clin Invest 120: 1674–1682. 10.1172/JCI40817 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Rayamajhi M, Humann J, Penheiter K, Andreasen K, Lenz LL (2010) Induction of IFN-alphabeta enables Listeria monocytogenes to suppress macrophage activation by IFN-gamma. J Exp Med 207: 327–337. 10.1084/jem.20091746 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Kearney SJ, Delgado C, Eshleman EM, Hill KK, O'Connor BP, et al. (2013) Type I IFNs downregulate myeloid cell IFN-gamma receptor by inducing recruitment of an early growth response 3/NGFI-A binding protein 1 complex that silences ifngr1 transcription. J Immunol 191: 3384–3392. 10.4049/jimmunol.1203510 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Silvennoinen O, Schindler C, Schlessinger J, Levy DE (1993) Ras-independent growth factor signaling by transcription factor tyrosine phosphorylation. Science 261: 1736–1739. [DOI] [PubMed] [Google Scholar]
- 29. Lee CK, Gimeno R, Levy DE (1999) Differential regulation of constitutive major histocompatibility complex class I expression in T and B lymphocytes. J Exp Med 190: 1451–1464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Heinrich PC, Behrmann I, Muller-Newen G, Schaper F, Graeve L (1998) Interleukin-6-type cytokine signalling through the gp130/Jak/STAT pathway. Biochem J 334 (Pt 2): 297–314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Stock AT, Smith JM, Carbone FR (2014) Type I IFN suppresses Cxcr2 driven neutrophil recruitment into the sensory ganglia during viral infection. J Exp Med 211: 751–759. 10.1084/jem.20132183 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Samuel CE (2001) Antiviral actions of interferons. Clin Microbiol Rev 14: 778–809, table of contents. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Goritzka M, Makris S, Kausar F, Durant LR, Pereira C, et al. (2015) Alveolar macrophage-derived type I interferons orchestrate innate immunity to RSV through recruitment of antiviral monocytes. J Exp Med 212: 699–714. 10.1084/jem.20140825 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Wareing MD, Lyon A, Inglis C, Giannoni F, Charo I, et al. (2007) Chemokine regulation of the inflammatory response to a low-dose influenza infection in CCR2-/- mice. J Leukoc Biol 81: 793–801. [DOI] [PubMed] [Google Scholar]
- 35. Dawson TC, Beck MA, Kuziel WA, Henderson F, Maeda N (2000) Contrasting effects of CCR5 and CCR2 deficiency in the pulmonary inflammatory response to influenza A virus. Am J Pathol 156: 1951–1959. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Lee PY, Li Y, Kumagai Y, Xu Y, Weinstein JS, et al. (2009) Type I interferon modulates monocyte recruitment and maturation in chronic inflammation. Am J Pathol 175: 2023–2033. 10.2353/ajpath.2009.090328 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Hanna RN, Carlin LM, Hubbeling HG, Nackiewicz D, Green AM, et al. (2011) The transcription factor NR4A1 (Nur77) controls bone marrow differentiation and the survival of Ly6C- monocytes. Nat Immunol 12: 778–785. 10.1038/ni.2063 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Yona S, Kim KW, Wolf Y, Mildner A, Varol D, et al. (2013) Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis. Immunity 38: 79–91. 10.1016/j.immuni.2012.12.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Hermesh T, Moltedo B, Moran TM, Lopez CB (2010) Antiviral instruction of bone marrow leukocytes during respiratory viral infections. Cell Host Microbe 7: 343–353. 10.1016/j.chom.2010.04.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Graham MB, Dalton DK, Giltinan D, Braciale VL, Stewart TA, et al. (1993) Response to influenza infection in mice with a targeted disruption in the interferon gamma gene. J Exp Med 178: 1725–1732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Price GE, Gaszewska-Mastarlarz A, Moskophidis D (2000) The role of alpha/beta and gamma interferons in development of immunity to influenza A virus in mice. J Virol 74: 3996–4003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42. Nguyen HH, van Ginkel FW, Vu HL, Novak MJ, McGhee JR, et al. (2000) Gamma interferon is not required for mucosal cytotoxic T-lymphocyte responses or heterosubtypic immunity to influenza A virus infection in mice. J Virol 74: 5495–5501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Blazek K, Eames HL, Weiss M, Byrne AJ, Perocheau D, et al. (2015) IFN-lambda resolves inflammation via suppression of neutrophil infiltration and IL-1beta production. J Exp Med 212: 845–853. 10.1084/jem.20140995 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Mordstein M, Kochs G, Dumoutier L, Renauld JC, Paludan SR, et al. (2008) Interferon-lambda contributes to innate immunity of mice against influenza A virus but not against hepatotropic viruses. PLoS Pathog 4: e1000151 10.1371/journal.ppat.1000151 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Wack A, Terczynska-Dyla E, Hartmann R (2015) Guarding the frontiers: the biology of type III interferons. Nat Immunol 16: 802–809. 10.1038/ni.3212 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Lazear HM, Nice TJ, Diamond MS (2015) Interferon-lambda: Immune Functions at Barrier Surfaces and Beyond. Immunity 43: 15–28. 10.1016/j.immuni.2015.07.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Gordon S, Martinez FO (2010) Alternative activation of macrophages: mechanism and functions. Immunity 32: 593–604. 10.1016/j.immuni.2010.05.007 [DOI] [PubMed] [Google Scholar]
- 48. Stifter SA, Feng CG (2015) Interfering with immunity: detrimental role of type I IFNs during infection. J Immunol 194: 2455–2465. 10.4049/jimmunol.1402794 [DOI] [PubMed] [Google Scholar]
- 49. Karupiah G, Chen JH, Mahalingam S, Nathan CF, MacMicking JD (1998) Rapid interferon gamma-dependent clearance of influenza A virus and protection from consolidating pneumonitis in nitric oxide synthase 2-deficient mice. J Exp Med 188: 1541–1546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Akaike T, Noguchi Y, Ijiri S, Setoguchi K, Suga M, et al. (1996) Pathogenesis of influenza virus-induced pneumonia: involvement of both nitric oxide and oxygen radicals. Proc Natl Acad Sci U S A 93: 2448–2453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Perrone LA, Belser JA, Wadford DA, Katz JM, Tumpey TM (2013) Inducible nitric oxide contributes to viral pathogenesis following highly pathogenic influenza virus infection in mice. J Infect Dis 207: 1576–1584. 10.1093/infdis/jit062 [DOI] [PubMed] [Google Scholar]
- 52. Garcia-Sastre A, Biron CA (2006) Type 1 interferons and the virus-host relationship: a lesson in detente. Science 312: 879–882. [DOI] [PubMed] [Google Scholar]
- 53. Kochs G, Garcia-Sastre A, Martinez-Sobrido L (2007) Multiple anti-interferon actions of the influenza A virus NS1 protein. J Virol 81: 7011–7021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Perrone LA, Plowden JK, Garcia-Sastre A, Katz JM, Tumpey TM (2008) H5N1 and 1918 pandemic influenza virus infection results in early and excessive infiltration of macrophages and neutrophils in the lungs of mice. PLoS Pathog 4: e1000115 10.1371/journal.ppat.1000115 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Cilloniz C, Shinya K, Peng X, Korth MJ, Proll SC, et al. (2009) Lethal influenza virus infection in macaques is associated with early dysregulation of inflammatory related genes. PLoS Pathog 5: e1000604 10.1371/journal.ppat.1000604 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.