. 2016 Jan 5;6(1):10. doi: 10.1007/s13205-015-0315-4

Table 1.

List of primers used for polymerase chain reaction in the study

Primer name	Nucleotide sequence	Amplicon size
S2XSF2	CCTAACATTGGTGGACTTCCAG	~800 bp internal sequence of cry2AX1 gene
S2XSR2	GAGAAACGAGCTCCGTTATCGT	~800 bp internal sequence of cry2AX1 gene
HF1	GCTGTTATGCGGCCATTGGTC	~630 bp internal sequence of hptII gene
HR1	GACGTCTGTCGAGAAGTTTG	~630 bp internal sequence of hptII gene
ActF1	GAGCGTTTCCGCTGCCCTGA	~500 bp internal sequence of Actin gene
ActR1	AGAAACAAGCAGGAGGACGGC	~500 bp internal sequence of Actin gene