Table 5. Primers and PCR settings used in this study.

Name	sequence 5′-3′	specificity	reference
First PCR, forward1
S1	AACCTGGTTGATCCTGCC	non-specific	Fiore-Donno et al. (2008)
First PCR, reverse
SRAca28	CCAATTACAAGACTCTTRTCGAG	Acanthamoeba	this work
SR19Dark	GTCCTCTAATTGTTACTCGAD	dark-spored Myxomycetes	this work
Second, semi-nested PCR, forward (reverse primers as before)2
SFAca22	CGGYGAGACTGCGGATGG	Acanthamoeba	this work
SF2Dark	GTTGATCCTGCCAGTAGTGT	dark-spored Myxomycetes	this work

¹40 cycles, 30 s at 95 °C, 60 s at 54.8 °C, 120 s at 72 °C, and a final elongation step of 5 min at 72 °C.

²35 cycles, 30 s at 95 °C, 60 s at 54 °C, 120 s at 72 °C, and a final elongation step of 5 min at 72 °C.