Skip to main content
PMC home page
ZooKeys logoLink to ZooKeys
. 2015 Nov 26;(540):273–298. doi: 10.3897/zookeys.540.9857

Cytogenetic and symbiont analysis of five members of the B. dorsalis complex (Diptera, Tephritidae): no evidence of chromosomal or symbiont-based speciation events

Antonios A Augustinos 1,2,3, Elena Drosopoulou 4, Aggeliki Gariou-Papalexiou 1, Elias D Asimakis 3, Carlos Cáceres 2, George Tsiamis 3, Kostas Bourtzis 2, Penelope Mavragani-Tsipidou 4, Antigone Zacharopoulou 1
PMCID: PMC4714073  PMID: 26798263

Abstract Abstract

The Bactrocera dorsalis species complex, currently comprising about 90 entities has received much attention. During the last decades, considerable effort has been devoted to delimiting the species of the complex. This information is of great importance for agriculture and world trade, since the complex harbours several pest species of major economic importance and other species that could evolve into global threats. Speciation in Diptera is usually accompanied by chromosomal rearrangements, particularly inversions that are assumed to reduce/eliminate gene flow. Other candidates currently receiving much attention regarding their possible involvement in speciation are reproductive symbionts, such as Wolbachia, Spiroplasma, Arsenophonus, Rickettsia and Cardinium. Such symbionts tend to spread quickly through natural populations and can cause a variety of phenotypes that promote pre-mating and/or post-mating isolation and, in addition, can affect the biology, physiology, ecology and evolution of their insect hosts in various ways. Considering all these aspects, we present: (a) a summary of the recently gained knowledge on the cytogenetics of five members of the Bactrocera dorsalis complex, namely Bactrocera dorsalis s.s., Bactrocera invadens, Bactrocera philippinensis, Bactrocera papayae and Bactrocera carambolae, supplemented by additional data from a Bactrocera dorsalis s.s. colony from China, as well as by a cytogenetic comparison between the dorsalis complex and the genetically close species, Bactrocera tryoni, and, (b) a reproductive symbiont screening of 18 different colonized populations of these five taxa. Our analysis did not reveal any chromosomal rearrangements that could differentiate among them. Moreover, screening for reproductive symbionts was negative for all colonies derived from different geographic origins and/or hosts. There are many different factors that can lead to speciation, and our data do not support chromosomal and/or symbiotic-based speciation phenomena in the taxa under study.

Keywords: Tephritidae, Wolbachia, inversions, polytene chromosomes

Introduction

The Bactrocera dorsalis species complex currently consists of approximately 90 entities, whose limits are not fully resolved (Drew and Hancock 1994, Drew and Romig 2013, Krosch et al. 2013, Boykin et al. 2014, Schutze et al. 2015). However, species delimitation is of paramount importance when dealing with economic important species, since it can influence world trade through implementation of quarantine policies and/or facilitate the application of species specific, environmental friendly control methods, such as the Sterile Insect Technique (SIT). Driven by these considerations, much effort has been invested in the last decades to clarify the species status within the complex. Among the most recent advances in this area, Drew and Romig (2013) synonymised Bactrocera papayae and Bactrocera philippinensis under Bactrocera papayae, while Schutze and colleagues (Scutze et al. 2015) have proposed the further synonymization of these two taxa and Bactrocera invadens with Bactrocera dorsalis s.s., under Bactrocera dorsalis s.s.

Recent studies have shown that efforts to resolve complex species status require multidisciplinary approaches (De Queiroz 2007, Schlick-Steiner et al. 2010), well-characterized material and extended sampling (Schutze et al. 2012, Krosch et al. 2013, Boykin et al. 2014). Such approaches have been also followed in other Tephritidae genera where species delimitation of species complexes is also an important concern, such as in Anastrepha (Selivon et al. 2005, Vera et al. 2006, Cáceres et al. 2009). This is due to the fact that speciation can be driven by a variety of forces, resulting in different speciation paths. The data basis can be complicated when speciation is ongoing (incipient). Therefore, in collaboration and through independent analysis, different research groups around the world, through the Coordinated Research Program: ‘Resolution of Cryptic Species Complexes of Tephritid Pests to Enhance SIT Application and Facilitate International Trade’ have accumulated a multitude of data that have contributed to the better understanding of the Tephritidae species complexes. One of the main targets was the resolution among five economic important taxa with unclear limits within the Bactrocera dorsalis complex. These were Bactrocera dorsalis s.s., Bactrocera papayae, Bactrocera philippinensis, Bactrocera invadens and Bactrocera carambolae.

A key pathway of speciation in Diptera is through chromosomal rearrangements (CRs), mainly inversions. More than fifty years of research on polytene chromosomes of Drosophila and mosquito species have shown that speciation is almost universally accompanied with inversions (Sturtevant and Dobzhansky 1936, Ashburner et al. 1982, Krimbas and Powell 1992, Noor et al. 2001, Rieseberg 2001, Kirkpatrick and Barton 2006, Bhutkar et al. 2008, Kulathinal et al. 2009, Stevison et al. 2011, Lee et al. 2013). The recent advances in whole genome sequencing and the availability of a number of genomes of Drosophila and mosquito species have verified the nuclear DNA rearrangements described in earlier cytogenetic studies (Kirkpatrick and Barton 2006, Ranz et al. 2007, Bhutkar et al. 2008, Schaeffer et al. 2008, Kulathinal et al. 2009, McGaugh and Noor 2012, Lee et al. 2013). Different models have been proposed to explain how CRs enhance speciation, recently focusing mainly on the restriction of recombination within and near inverted regions as the causal factor of restriction in gene flow (Noor et al. 2001, Rieseberg 2001, Kirkpatrick and Barton 2006, Faria and Navarro 2010).

However, sequencing of entire genomes cannot yet be easily applied to species with bigger genomes and a high proportion of repetitive DNA sequences. Shotgun sequencing approaches are relatively quick and cheap, but cannot provide insight into higher chromosomal organization of species lacking of a complete sequenced reference genome, at least up to now. Regarding the Bactrocera dorsalis complex, the draft genome of Bactrocera dorsalis s.s. currently consists of more than 86,000 contigs (http://www.ncbi.nlm.nih.gov/assembly/GCF_000789215.1). Even though the construction of several genome databases of Tephritidae species is ongoing, this methodology is so far (a) too slow and expensive to screen a large number of different populations and (b) it is not guaranteed to reveal structural chromosomal changes between species, unless coupled with molecular and genetic approaches, such as Sanger sequencing, cloning and in situ hybridization. Direct observation and comparison of chromosomes is still a very powerful approach to shed light on the higher organization and structure of chromosomes. Although mitotic chromosomes can also provide some information, polytene chromosomes are an excellent tool for resolution of CRs.

In Tephritids, there is a number of studies presenting and discussing mitotic karyotypes, especially for Bactrocera (Hunwattanakul and Baimai 1994, Baimai et al. 1995, 1999, 2000, Baimai 1998, 2000), Anastrepha (Cevallos and Nation 2004, Selivon et al. 2005, Goday et al. 2006, Selivon et al. 2007) and Rhagoletis species (Bush and Boller 1977). However, useful polytene chromosome maps, so far available for five genera, represent only 11 species: one of Anastrepha (Anastrepha ludens) (Garcia-Martinez et al. 2009), one of Ceratitis (Ceratitis capitata) (Zacharopoulou 1990), one of Dacus (Dacus ciliatus) (Drosopoulou et al. 2011b) and three of Rhagoletis, namely Rhagoletis cerasi (Kounatidis et al. 2008), Rhagoletis cingulata (Drosopoulou et al. 2011a) and Rhagoletis completa (Drosopoulou et al. 2010). The genus Bactrocera can be regarded as the best studied so far, including four species of three different subgenera. These are Bactrocera oleae (subgenus Daculus) (Mavragani-Tsipidou et al. 1992), Bactrocera cucurbitae (subgenus Zeugodacus) (Zacharopoulou et al. 2011b) and Bactrocera dorsalis s.s. (Zacharopoulou et al. 2011a) plus Bactrocera tryoni (subgenus Bactrocera) (Zhao et al. 1998).

Cytogenetic studies have been used to distinguish between different members of the Bactrocera dorsalis complex in the past, based on mitotic chromosomes. Hunwattanakul and Baimai (1994) presented the typical karyotype of Bactrocera dorsalis, which is being referred to as form A. The mitotic karyotype of the complex is 2n = 12, consisting of five pairs of autosomes and a heterogametic XX/XY sex chromosome pair. In the following years, Baimai and colleagues presented numerous species within the complex with distinct mitotic karyotypes (Baimai et al. 1995, 2000, Baimai 1998). Although these studies are of great importance and reveal the power of cytogenetics for the resolution of species limits within species complexes, they suffered from limitations that could not be addressed or even predicted in the previous years. These include (a) the ongoing debate on species limits and taxonomy of the complex, (b) utilization of material from the field that cannot be evaluated with other approaches, since it was not colonized and, (c) lack of robust diagnostic tools within this complex. All these indicate that older taxonomic conclusions should be used with care and seen in the light of recent advances in the field.

To overcome such constraints, recent cytogenetic studies have used laboratory colonies from the Joint FAO/IAEA Insect Pest Control Laboratory (IPCL). These colonies are also material in a variety of research programs, are always available for further analyses and their status is routinely verified by expert taxonomists. Zacharopoulou and colleagues analysed colonized material of Bactrocera dorsalis s.s., derived from Thailand and from a Genetic Sexing Strain (GSS) constructed in Hawaii (Zacharopoulou et al. 2011a). In this study, the form A mitotic karyotype was verified for Bactrocera dorsalis s.s., and polytene chromosome map for this species was constructed, which includes 10 polytene arms. These arms correspond to the autosomes, which is consistent with the already described non-polytenization of the sex chromosomes in Tephritidae (Zacharopoulou 1990, Mavragani-Tsipidou et al. 1992, Zhao et al. 1998, Garcia-Martinez et al. 2009, Drosopoulou et al. 2010, Zacharopoulou et al. 2011a, Zacharopoulou et al. 2011b, Drosopoulou et al. 2011a, Drosopoulou et al. 2011b, Drosopoulou et al. 2012). Recently, a more extended cytogenetic analysis was performed (Augustinos et al. 2014b), shedding more light on the resolution of the species limits of the five taxa described before. Six laboratory colonies, representing Bactrocera dorsalis s.s. (two colonies), Bactrocera papayae, Bactrocera philippinensis, Bactrocera invadens and Bactrocera carambolae, were examined (Table 1) and all exhibited the form A mitotic karyotype. This was quite a surprise, since it is not in agreement with previous studies, where a distinct karyotype with a quite large X chromosome, carrying an ‘elongated’ arm with a secondary constriction, was described for Bactrocera carambolae from Thailand (Baimai et al. 1999). In addition, polytene chromosomes did not reveal any fixed CRs among these five taxa that could be used as diagnostic markers (Augustinos et al. 2014b).

Table 1.

Material used in the present study.

No Species Origin Reproductive symbiont screening* Cytogenetically analyzed
M F
1 Bactrocera dorsalis Saraburi, Thailand 10 10 Zacharopoulou et al. 2011a
Augustinos et al. 2014b
2 Bactrocera dorsalis Nakhon Sri Thammarat, Thailand 10 10 Augustinos et al. 2014b
3 Bactrocera dorsalis G17 Bangkok, Thailand 10 10
4 Bactrocera dorsalis GSS Hawaii 10 10 Zacharopoulou et al. 2011a;
Zacharopoulou and Franz 2013
5 Bactrocera dorsalis (White body) OAP, Bangkok, Thailand 10 10
6 Bactrocera dorsalis Yunnan, China 10 10
7 Bactrocera dorsalis Fujian, china 10 10
8 Bactrocera dorsalis Pakistan 10 10
9 Bactrocera dorsalis Myanmar 10 10
10 Bactrocera dorsalis India 10 10
11 Bactrocera dorsalis Wuhan, China (colony 1) 10 10 Present study
12 Bactrocera dorsalis Wuhan, China (colony 2) 10 10
13 Bactrocera carambolae Paramaribo,
Suriname		 10 10 Augustinos et al. 2014b
14 Bactrocera carambolae Serdang, Malaysia 10 10
15 Bactrocera philippinensis Guimaras Island, Philippines 10 10
16 Bactrocera philippinensis Philippines 10 10 Augustinos et al. 2014b
17 Bactrocera papayae Serdang,
Malaysia		 10 10 Augustinos et al. 2014b
18 Bactrocera invadens Kenya 10 10 Augustinos et al. 2014b
19 Bactrocera tryoni Australia 10 10 Present study
Open in a new tab

*Twenty flies were screened for the presence of the five reproductive symbionts listed in Table 2. None was positive for none of the symbionts.

A second factor that should not be overlooked in studies addressing speciation phenomena is the presence of specific symbiotic bacteria, especially those referred to as ‘reproductive parasites’. These are symbiotic bacteria mainly found in reproductive tissues and are best known to interfere with host reproduction, inducing a variety of phenotypes such as male killing, parthenogenesis, feminization and Cytoplasmic Incompatibility (CI). Among them, Cardinium, Arsenophonus, Spiroplasma, Rickettsia and Wolbachia are commonly found in different arthropods (Bourtzis and Miller 2003, 2006, 2009, Perlman et al. 2006, Duron et al. 2008a, Werren et al. 2008, Saridaki and Bourtzis 2010, Zchori-Fein and Bourtzis 2011).

Wolbachia is probably the most ubiquitous bacterial symbiont in insects (Hilgenboecker et al. 2008, Zug and Hammerstein 2012) and is regarded as a putative ‘speciation agent’, since it can restrict gene flow through (CI) and lead to the selection and fixation of specific genotypes in a population. Wolbachia-induced CIs can co-exist with local selection on alleles involved in incompatibilities and, therefore, increase the migration rates that genetic variability can experience without getting lost. The combined act of the two aforementioned forces of incompatibility can lead to maintenance of the divergence among populations and enhance speciation (Flor et al. 2007, Telschow et al. 2007, 2014). Besides theoretical and model predictions, the implication of Wolbachia in pre- and / or post-mating isolation phenomena has been experimentally supported in different insect systems including the parasitic wasps of the genus Nasonia (Bordenstein et al. 2001, Bordenstein and Werren 2007) and Drosophila (Jaenike et al. 2006, Koukou et al. 2006, Miller et al. 2010).

In tephritids, most studies have so far focused on the detection and characterization of Wolbachia infections. Although screening is far from complete, well-established infections have been found in some species. The best characterized species is Rhagoletis cerasi, since all natural populations studied so far are 100% infected, usually with multiple-strain infections (Riegler and Stauffer 2002, Kounatidis et al. 2008, Arthofer et al. 2009, Augustinos et al. 2014a, Karimi and Darsouei 2014). More importantly, it is a well-documented example of the implication of Wolbachia in restriction in gene flow and enhancement of incompatibility between natural populations of the species (Riegler and Stauffer 2002). Other Rhagoletis species that seem to have persistent and multiple strain infections (although less populations are studied) are Rhagoletis pomonella (Schuler et al. 2011) and Rhagoletis cingulata (Drosopoulou et al. 2011a, Schuler et al. 2013), along with some Rhagoletis species of Japan (Coats et al. 2013). Outside Rhagoletis, the only species demonstrating persistent Wolbachia infections is Anastrepha fraterculus, (Selivon et al. 2002, Cáceres et al. 2009, Coscrato et al. 2009, Marcon et al. 2011, Martinez et al. 2012). All other tephritid species are so far considered as Wolbachia-free or only exhibiting low prevalence infections. Among them, Ceratitis capitata is also considered as Wolbachia-free (Bourtzis et al. 1994, Zabalou et al. 2004); however, there are two reports from a research group in Latin America discussing the presence of Wolbachia in local populations of the species (Rocha et al. 2005, Coscrato et al. 2009). The recent study on the Wolbachia presence in Australian fruit flies (Morrow et al. 2015) has extended our knowledge on the Wolbachia status of Tephritidae in a relatively unexplored area. In accordance with previous studies, few species were found infected and only a relatively small (although varying) percentage of individuals. However, this study demonstrated the presence of different Wolbachia strains, shared among natural populations of different species, raising the possibility of recent horizontal transmission events through shared parasitoids. Regarding the other four symbionts, there are up to now no reports of infected populations, at least to our knowledge. Especially for the Bactrocera dorsalis complex, there are only three reports of Wolbachia infections in natural populations. In all these cases, infections were found at a very low prevalence in nature (Kittayapong et al. 2000, Jamnongluk et al. 2002, Sun et al. 2007).

The purpose of this study was to (a) summarize gained knowledge and (b) provide new evidence regarding the cytogenetic and symbiotic status of the Bactrocera dorsalis complex, with the aim to identify factors possibly involved in speciation. Focus has been given on five taxa of economic importance and unclear species limits, namely Bactrocera dorsalis s.s., Bactrocera papayae, Bactrocera philippinensis, Bactrocera invadens and Bactrocera carambolae. Only material colonized at the Joint FAO/IAEA IPCL was analysed, that was also used in other Joint FAO/IAEA IPCL research programs (Wee et al. 2002, Krosch et al. 2013, Boykin et al. 2014, Schutze et al. 2013, Tan et al. 2013, Bo et al. 2014). More specifically, our cytogenetic analysis was extended to (a) a Bactrocera dorsalis s.s. population derived from China, a cytogenetically unexplored area of great interest for the complex, (b) a new Australian colony of Bactrocera tryoni, a species that is genetically discrete though not phylogenetically distant from the Bactrocera dorsalis complex and (c) F1 bidirectional hybrids of Bactrocera dorsalis s.s. and Bactrocera tryoni. In addition, an extensive PCR screening was performed aiming at the detection of the five aforementioned reproductive symbionts in 18 different colonies available for the dorsalis complex and the colony representing Bactrocera tryoni (Table 1).

Methods

Material used

Nineteen colonies currently kept at the Joint FAO/IAEA IPCL were screened for the presence of different reproductive symbionts (Table 1). Eighteen of them represent the five members of the complex under discussion (Bactrocera dorsalis s.s., Bactrocera papayae, Bactrocera philippinensis, Bactrocera invadens and Bactrocera carambolae), while one colony represents Bactrocera tryoni from Australia that was included as a closely related outgroup. Two colonies were cytogenetically analysed (Bactrocera dorsalis s.s. from China-Wuhan and Bactrocera tryoni from Australia) and were added to the seven colonies previously analysed (see Table 1 and references therein). The F1 bidirectional hybrids of Bactrocera dorsalis s.s. × Bactrocera tryoni were also analysed.

Mitotic chromosome preparations

Chromosome preparations were made as described in Zacharopoulou (1990) and Mavragani-Tsipidou et al. (2014). Brain tissue was dissected in 0.7% NaCl, transferred to 1% sodium citrate on a well slide for at least 15 min and fixed in fresh fixation solution (methanol/acetic acid 3:1) for 3 min. Fixation solution was removed and a drop of acetic acid (60%) was added. Tissue was dispersed using a micropipette and the cell suspension was dried on a clean slide placed on a hotplate (40–45 °C). Chromosomes were stained with Giemsa (5% Giemsa in 10 mM phosphate buffer, pH 6.8). Chromosome slides were analysed at 100× magnification, using a phase contrast microscope (Leica DMR), and photographs were taken using a CCD camera (ProgRes CFcool; Jenoptik Jena Optical Systems, Jena, Germany). At least 15 good quality preparations per sample and at least 10 well-spread nuclei per preparation were analysed.

Polytene chromosome preparations

Polytene chromosome preparations were made from 3rd instar larvae, as described in Zacharopoulou (1990), Mavragani-Tsipidou et al. (2014). Larvae were dissected in acetic acid (45%), and salivary glands were transferred to HCl (3 N) for 1 min, fixed in 3:2:1 fixation solution (3 parts acetic acid: 2 parts water: 1 part lactic acid) for ~5 min (until transparent) and stained in 2% lacto-aceto-orcein for 5–7 min. Glands were washed with 3:2:1 solution to remove excess stain and squashed. Chromosome slides were analysed at 100× magnification using a phase contrast microscope (Leica DMR) and photographs were taken using a CD camera (ProgRes CFcool; Jenoptik Jena Optical Systems, Jena, Germany). At least 15 good quality preparations per sample and at least 10 well spread nuclei per preparation were analysed.

DNA extraction and PCR screening for reproductive symbionts

DNA was extracted from single flies, using the CTAB protocol (Doyle and Doyle 1990). To verify DNA quality, PCRs were performed for randomly selected samples with the universal primer pair 12SCFR/12SCRR that amplifies 420 bp of the insect mitochondrial 12S rRNA gene (Hanner and Fugate 1997). In total, 380 samples were screened for the presence of Wolbachia, Spiroplasma, Arsenophonus, Rickettsia and Cardinium. Screening was performed using bacterial species-specific 16S rRNA gene-based PCR. Depending on the set of primers used, the amplified DNA fragment varied in size from 200 bp to 611 bp. The amplification was performed in 20 µl reactions, each containing 2 µl of 10× KAPA Taq Polymerase Buffer A (with 1.5 mM of MgCl2 at 1×), 0.1 µl of dNTPs (25 mM), 0.5 µl of the forward primer (25 µM), 0.5 µl of the reverse primer (25 µM), 0.1 µl of KAPA Taq DNA Polymerase (5 U/µl), 15.8 µl of sterile double distilled water and 1 µl of DNA. The PCR protocol included an initial 5 minute denaturation at 95 °C, followed by 35 cycles of 30 seconds at 95 °C, 30 seconds at the optimum melting temperature for each pair of specific primers, 1 minute at 72 °C and a final extension step of 10 minutes at 72 °C, with the exception of Wolbachia, where 30 cycles were used. The products were electrophoresed on a 1.5 % agarose gel in order to determine the presence and size of the fragments. Primer pairs and PCR conditions are summarized in Table 2.

Table 2.

PCR screening for five reproductive symbionts.

Genus Primer 5’-3’ Tm°C Product Size Reference
Wolbachia wspecF
YATACCTATTCGAAGGGATAG		 55 °C 438 bp Werren and Windsor 2000
wspecR
AGCTTCGAGTGAAACCAATTC
Spiroplasma 63F_CG 60 °C 450 bp Mateos et al. 2006
Fukatsu and Nikoh 2000
GCCTAATACATGCAAGTCGAACGG
TKSSspR
TAGCCGTGGCTTTCTGGTAA
Arsenophonus ArsF 56 °C 611 bp Duron et al. 2008b
GGGTTGTAAAGTACTTTCAGTCGT
ArsR5
CCCTAAGGCACGYYTYTATCTCTAA
Rickettsia 16SA1 55 °C 200 bp Fukatsu and Nikoh 2000
AGAGTTTGATCTGGCTCAG
Rick16SR
CATCCATCAGCGATAAATCTTTC
Cardinium CLO-f1 56 °C 466 bp Gotoh et al. 2007
GGAACCTTACCTGGGCTAGAATGTATT
CLO-r1
GCCACTGTCTTCAAGCTCTACCAAC
Open in a new tab

Results and discussion

As already stated in the Introduction, material colonized in IPCL was used in the present study. This is in the frame of utilizing multi-disciplinary approaches, using the same samples if possible, to contribute to the species resolution in the dorsalis complex (Schutze et al. 2015). For such approaches utilization of colonized, well-characterized material is essential. This is even more evident for cytogenetics, since live material is needed. On the other hand, results obtained from laboratory colonies must be verified in larger samples of different origin before elevating to species level. As it has been shown by different studies (Gilchrist et al. 2012; Parreño et al. 2014, Zygouridis et al. 2014), lab colonization is accompanied by an adaptation process including severe bottlenecks, hitch-hiking effects and extended inbreeding. This can affect the genetic structure of the populations and, possibly, their symbiotic communities. Therefore, results derived from colonized material should be ‘interpreted’ wisely and in combination with the analysis of natural collections.

Mitotic karyotypes – agreements and inconsistencies with older studies

The Bactrocera dorsalis s.s. colony from China showed the Bactrocera dorsalis s.s. mitotic karyotype known as form A. This is the typical and probably ancestral karyotype of the dorsalis complex. The above, together with previous results, show that the Joint FAO/IAEA IPCL colonies, representing the five investigated taxa, possess the same mitotic karyotype (Zacharopoulou et al. 2011a, Zacharopoulou and Franz 2013, Augustinos et al. 2014b). Older studies (Baimai et al. 1999) describe a different karyotype for Bactrocera carambolae from Thailand. Although the Bactrocera carambolae colony analysed recently, available at the Joint FAO/IAEA IPCL (Augustinos et al. 2014b), was derived from a Suriname population, it is highly unlikely that the different origin is the explanation for this difference. Incorrect species identification due to the limitations discussed in the Introduction Section is the most probable explanation. This is further supported by the fact that an independent study on the mitotic karyotypes of Bactrocera carambolae from Malaysia also found the typical form A karyotype for this taxon (Yesmin and Clyde 2012).

The examination of new material representing Bactrocera tryoni from Australia was in accordance with the previously published mitotic karyotype for this species (Zhao et al. 1998). This karyotype has five pairs of autosomes and a heterogametic XX/XY sex chromosome pair. The three larger autosome pairs are metacentric to submetacentric, while the two shorter autosome pairs are submetacentric to acrocentric. Y is the smallest of the set, while X is large and probably larger than or comparable to the largest autosomes.

Polytene chromosome comparisons and species resolution

Polytene chromosome nuclei of Bactrocera dorsalis s.s. from China are shown in Figure 1. Its polytene chromosomes show the same banding pattern with the published maps of Bactrocera dorsalis s.s. (Zacharopoulou et al. 2011a), and therefore can be regarded as homosequential with all other colonies analysed so far (Augustinos et al. 2014b). The characteristic asynapsis at regions 73–74 of arm 5R previously observed in all colonies (Zacharopoulou et al. 2011a, Augustinos et al. 2014b) was also found here at a relatively high frequency (Figure 2). Its polymorphic presence in all colonies analysed so far points to the close genetic proximity of these five taxa.

Figure 1.

Figure 1.

Open in a new tab

a, b Polytene nuclei of Bactrocera dorsalis s.s. from China. Chromosome arms are shown. Tips are marked with arrows and centromeres are indicated with ‘C’.

Figure 2.

Figure 2.

Open in a new tab

a–e Characteristic asynapsis in 5R chromosome arm, close to the centromere (regions 73–74), observed in the Bactrocera dorsalis s.s. colony derived from China. Asterisks (*) mark the asynaptic region, while ‘C’ marks the 5R centromere.

Another interesting finding from the analysis of the China colony is the high presence of an asynapsis at the telomeric region of 3L (Figure 3). Although previously observed in other colonies (Zacharopoulou et al. 2011a, Augustinos et al. 2014b), its frequency in the specific colony is much higher than in the colonies analysed before. Again, this can be considered as an inter species, intra population variation.

Figure 3.

Figure 3.

Open in a new tab

Characteristic asynapsis in the 3L, close to the tip region, observed in Bactrocera dorsalis colony derived from China. a almost completely synapsed region b–d asynapses of the same region; asterisks (*) indicate the specific region.

In the recent proposed revisions that synonymize four out of the five Dorsalis taxa under study (Drew and Romig 2013, Schutze et al. 2015), Bactrocera carambolae is maintained as a distinct species within the complex, but closely related to Bactrocera dorsalis s.s. The recent cytogenetic analysis on these five taxa failed to find any fixed diagnostic CRs among Bactrocera dorsalis s.s. and Bactrocera carambolae (Augustinos et al. 2014b). However, as discussed in that paper, the high frequency of small asynapses observed in the Bactrocera dorsalis s.s. × Bactrocera carambolae F1 hybrids, in comparison to the Bactrocera dorsalis s.s. × Bactrocera invadens F1 hybrids could be an indication of the presence of small CRs between the Bactrocera dorsalis s.s. and Bactrocera carambolae genomes, undetected with microscopy.

To explore the limitations of cytogenetic analysis in species resolution, we performed a polytene chromosome comparison between the dorsalis complex and Bactrocera tryoni, a species also belonging to the subgenus Bactrocera and routinely used as a closely related outgroup in different studies (Krosch et al. 2012; Boykin et al. 2014; Virgilio et al. 2015). To do so, polytene chromosome squashes from an IPCL laboratory colony were prepared and directly compared with the published Bactrocera dorsalis s.s. map (Zacharopoulou et al. 2011a), the already published Bactrocera tryoni map (Zhao et al. 1998) and photos from polytene chromosomes of the five taxa of the dorsalis complex. This analysis showed that this colony is homosequential with the previously published map of Bactrocera tryoni. A comparison between Bactrocera tryoni and the five dorsalis taxa showed that nine of the ten polytene arms can be regarded as highly homosequential, verifying the genetic proximity between them (Figures 4–6). However, a fixed chromosomal inversion that was previously described (Augustinos et al. 2014b), based on a comparison of polytene chromosome maps of the two species (Bactrocera dorsalis s.s. and Bactrocera tryoni), was verified in the new polytene chromosome squashes of the IPCL colony (Figure 7). This CR is quite extended, covering a large region of arm 2R.

Figure 4.

Figure 4.

Open in a new tab

Comparison of the 3L polytene chromosome arm of a Bactrocera tryoni and b Bactrocera dorsalis s.s.. Dot lines connect characteristic landmarks of the two chromosomes.

Figure 6.

Figure 6.

Open in a new tab

Comparison of the 5L polytene chromosome arms of a Bactrocera tryoni and b Bactrocera dorsalis s.s.. Dot lines connect characteristic landmarks of the two chromosomes.

Figure 7.

Figure 7.

Open in a new tab

The inverted region on the 2R polytene arm that differentiates Bactrocera tryoni from the five members of the Bactrocera dorsalis complex: a Bactrocera tryoni b Bactrocera dorsalis s.s. Dotted lines mark the chromosomal region involved in the inversion while arrows indicate the orientation.

Figure 5.

Figure 5.

Open in a new tab

Comparison of the 4L polytene chromosome arms of a Bactrocera tryoni and b Bactrocera dorsalis s.s.. Dot lines connect characteristic landmarks of the two chromosomes.

To further verify the proposed syntenies, a cytogenetic analysis of F1 bidirectional hybrids of Bactrocera dorsalis s.s. and Bactrocera tryoni was performed. Consistently with the aforementioned conclusions good synapsis can be seen in 9/10 polytene arms, while asynaptic regions are also present, as expected for hybrids of well-differentiated species (Figure 8). The inversion covering a large part of the 2R chromosome arm (Figure 8b) can also be observed, although its extension usually leads to chromosome breaks that make the mapping of breakpoints rather difficult (Figure 9).

Figure 8.

Figure 8.

Open in a new tab

a, b Polytene nuclei derived from the F1 Bactrocera dorsalis s.s. × Bactrocera tryoni hybrids. Chromosome arms are indicated. Tips are marked with arrows and centromeres are indicated with ‘C’. Note the overall banding pattern homosequentiallity and the presence of limited asynapses.

Figure 9.

Figure 9.

Open in a new tab

a–e Part of the 2R chromosome arm including the fixed inversion. Photos derived from different polytene chromosome preparations. Asterisks (*) indicate the inversion breakpoints. ‘C’ indicates the 2R centromere.

As discussed in the Introduction, CRs are regarded as key players in Diptera speciation. In Tephritidae, all species analysed so far are differentiated by CRs, mainly inversions and transpositions. Focusing on the better studied Tephritidae species (Ceratitis capitata) and species of two genera that are phylogenetically close to each other (Bactrocera and Dacus), polytene chromosome comparisons performed either in older studies or in the present study have revealed specific CRs that are diagnostic in genus, subgenus and species level. Comparative analysis of the published polytene chromosome maps shows that the pericentric inversion in chromosome 5, firstly described by Zhao et al. (1998), also differentiates Ceratitis capitata from the other four Dacus/Bactrocera species studied so far (Zacharopoulou 1990, Mavragani-Tsipidou et al. 1992, Zacharopoulou et al. 2011a, 2011b, Drosopoulou et al. 2011b). Within the Dacus/Bactrocera clade, polytene chromosomes provide evidence for the genetic proximity of BactroceraZeugodacus and BactroceraDaculus (to a lesser extend) with Dacus. More specifically, there are certain CRs shared between Bactrocera cucurbitae (Zeugodacus), Bactrocera oleae (Daculus) and Dacus ciliatus in contrast to the two species of the Bactrocera subgenus (Bactrocera dorsalis s.s. and Bactrocera tryoni). A characteristic example is a pericentric inversion in chromosome 6 that changes the length ratio of the two arms, clearly evident when comparing the maps of these species (Mavragani-Tsipidou et al. 1992, Zhao et al. 1998, Zacharopoulou et al. 2011a, 2011b, Drosopoulou et al. 2011b). On the other hand, Bactrocera oleae shares also some characteristic CRs with the typical Bactrocera (Mavragani-Tsipidou et al. 1992, Zhao et al. 1998, Zacharopoulou et al. 2011a, 2011b, Drosopoulou et al. 2011b). Informative is also chromosome 2, since its right arm is considered as highly polymorphic among the different Tephritidae species. The region involved in the 2R inversion described before does not only differentiate Bactrocera tryoni from the Bactrocera dorsalis taxa analysed so far. This region has a unique banding pattern and/or position among the five Bactrocera/Dacus species analysed so far (Mavragani-Tsipidou et al. 1992, Zhao et al. 1998, Zacharopoulou et al. 2011a, 2011b, Drosopoulou et al. 2011b). All the above findings are in accordance with recent studies discussing either the genetic proximity of specific Bactrocera subgenera with Dacus or the actual status of specific subgenera, especially the Zeugodacus subgenus (Virgilio et al. 2009, Krosch et al. 2012, Virgilio et al. 2015).

Taking together that (a) all different Tephritidae species analysed so far exhibit characteristic CRs and (b) no diagnostic CRs could be observed in the five taxa of the Bactrocera dorsalis complex analysed here, it is clear that polytene chromosome analysis does so far not support a CR-mediated speciation event in the taxa under study.

Reproductive symbiont screening – lack of evidence for symbiotic involvement in speciation events

The PCR screening for Arsenophonus, Cardinium, Spiroplasma, Rickettsia and Wolbachia did not reveal any signs of infection in the 19 colonies tested (Table 1). However, since this analysis was performed on populations colonized for many generations, this does not necessarily represent the ‘actual’ symbiotic status of these species in the wild. Colonization might have drastically affected the symbiotic communities of the respective populations. Although there is no evidence for the implication of reproductive symbionts on speciation events between the investigated taxa, symbiotic analysis of wild populations is thus crucial to fully resolve the symbiotic status of these taxa and the dorsalis complex in general.

In Tephritidae, only Wolbachia has so far been found in a limited number of species, while there are no reports of the presence of the other four symbionts. This can partly be attributed to a lack of comprehensive surveys. Regarding the Bactrocera dorsalis complex, there are reports for the presence of Wolbachia in natural populations (Kittayapong et al. 2000, Jamnongluk et al. 2002, Sun et al. 2007), however only a few populations and at very low frequencies. The first of them (Kittayapong et al. 2000) reports a Wolbachia PCR screening of fruit flies of Thailand, collected in the years 1995-1998. Screening was based on the ftsZ gene and supergroup-typing on wsp sequences. Only 2/222 of the mitotic form A samples and one out of two of the mitotic form K samples were infected. The infection was reported as belonging to supergroup B. Later on, the same research group, using the same samples, suggested the presence of multiple Wolbachia infections (Jamnongluk et al. 2002). More recently, a study performed on Chinese populations of Bactrocera dorsalis s.s. (Sun et al. 2007) revealed very low levels of Wolbachia infections (19 positive samples of 1500), belonging either to supergroup A or B, based on wsp sequencing. Given the available knowledge at the time of these screens, the specimens tested might have not been properly identified at the species level. In any case, it is highly unlikely that at such low frequencies Wolbachia infection could trigger or support a speciation event.

Conclusion

CRs are a well-known indicator of speciation in Diptera, while symbionts obtain only during the last years more recognition as putative speciation factors. Analysing possible paths of speciation with multidisciplinary approaches (integrative taxonomy) is now acknowledged as the best way to provide robust results in species delimitation (De Queiroz 2007, Schlick-Steiner et al. 2010). Our analysis, focused on five economically important members of the Bactrocera dorsalis complex currently colonized at the Joint FAO/IAEA IPCL, failed to identify any fixed CRs or specific reproductive symbionts that could have participated in the speciation process in the complex. These results are in line with recent data that question the ‘actual’ number of species within the Bactrocera dorsalis complex (Krosch et al. 2013, Schutze et al. 2013, San Jose et al. 2013, Boykin et al. 2014) and have led to the recent synonymization proposed by Schutze and colleagues (Schutze et al. 2015). Analysis of species within the complex that are more clearly differentiated from the five taxa under study could shed more light on the speciation process within the Bactrocera dorsalis complex.

Acknowledgements

The present study has been partially funded by the Joint FAO/IAEA Coordinated Research Project (CRP) ‘Resolution of Cryptic Species Complexes of Tephritid Pests to Enhance SIT Application and Facilitate International Trade’. We would also like to thank the three reviewers for their constructive comments.

Citation

Augustinos AA, Drosopoulou E, Gariou-Papalexiou A, Asimakis ED, Cáceres C, Tsiamis G, Bourtzis K, Mavragani-Tsipidou P, Zacharopoulou A (2015) Cytogenetic and symbiont analysis of five members of the B. dorsalis complex (Diptera, Tephritidae): no evidence of chromosomal or symbiont-based speciation events. In: De Meyer M, Clarke AR, Vera MT, Hendrichs J (Eds) Resolution of Cryptic Species Complexes of Tephritid Pests to Enhance SIT Application and Facilitate International Trade. ZooKeys 540: 273–298. doi: 10.3897/zookeys.540.9857

References

  1. Arthofer W, Riegler M, Schneider D, Krammer M, Miller WJ, Stauffer C. (2009) Hidden Wolbachia diversity in field populations of the European cherry fruit fly, Rhagoletis cerasi (Diptera, Tephritidae). Molecular Ecology 18: 3816–3830. doi: 10.1111/j.1365-294X.2009.04321.x [DOI] [PubMed] [Google Scholar]
  2. Ashburner M, Carson HL, Thompson J. (1982) The Genetics and Biology of Drosophila. Ashburner M, Carson HL, Thompson J (Eds) Academic press, London.
  3. Augustinos AA, Asimakopoulou AK, Moraiti CA, Mavragani-Tsipidou P, Papadopoulos NT, Bourtzis K. (2014a) Microsatellite and Wolbachia analysis in Rhagoletis cerasi natural populations: population structuring and multiple infections. Ecology and Evolution 4: 1943–1962. doi: 10.1002/ece3.553 [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Augustinos AA, Drosopoulou E, Gariou-Papalexiou A, Bourtzis K, Mavragani-Tsipidou P, Zacharopoulou A. (2014b) The Bactrocera dorsalis species complex: comparative cytogenetic analysis in support of Sterile Insect Technique applications. BMC Genetics 15 Suppl 2: S16. doi: 10.1186/1471-2156-15-S2-S16 [DOI] [PMC free article] [PubMed]
  5. Baimai V. (1998) Heterochromatin accumulation and karyotypic evolution in some dipteran insects. Zoological Studies 37: 75–88. [Google Scholar]
  6. Baimai V. (2000) Cytological evidence for a complex of species within the taxon Bactrocera tau (Diptera: Tephritidae) in Thailand. Biological Journal of the Linnean Society 69: 399–409. doi: 10.1006/bijl.1999.0377 [Google Scholar]
  7. Baimai V, Phinchongsakuldit J, Tigvattananont S. (1999) Metaphase karyotypes of fruit flies of Thailand. IV. Evidence for six new species of the Bactrocera dorsalis complex. Cytologia 64: 371–377. doi: 10.1508/cytologia.64.371 [DOI] [PubMed] [Google Scholar]
  8. Baimai V, Sumrandee C, Tigvattananont S, Trinachartvanit W. (2000) Metaphase karyotypes of fruit flies of Thailand. V. Cytotaxonomy of ten additional new species of the Bactrocera dorsalis complex. Cytologia 65: 409–417. doi: 10.1508/cytologia.65.409 [DOI] [PubMed] [Google Scholar]
  9. Baimai V, Trinachartvanit W, Tigvattananont S, Grote PJ, Poramarcom R, Kijchalao U. (1995) Metaphase karyotypes of fruit flies of Thailand. I. Five sibling species of the Bactrocera dorsalis complex. Genome 38: 1015–1022. doi: 10.1139/g95-134 [DOI] [PubMed] [Google Scholar]
  10. Bhutkar A, Schaeffer SW, Russo SM, Xu M, Smith TE, Gelbart WM. (2008) Chromosomal rearrangement inferred from comparisons of 12 Drosophila genomes. Genetics 179: 1657–1680. doi: 10.1534/genetics.107.086108 [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Bo W, Ahmad S, Dammalage T, Tomas US, Wornoayporn V, Ul Haq I, Cáceres C, Vreysen MJB, Hendrichs J, Schutze MK. (2014) Mating compatibility between Bactrocera invadens and Bactrocera dorsalis (Diptera: Tephritidae). Journal of Economic Entomology 107: 623–629. doi: 10.1603/EC13514 [DOI] [PubMed] [Google Scholar]
  12. Bordenstein SR, O’Hara FP, Werren JH. (2001) Wolbachia-induced incompatibility precedes other hybrid incompatibilities in Nasonia. Nature 409: 707–710. doi: 10.1038/35055543 [DOI] [PubMed] [Google Scholar]
  13. Bordenstein SR, Werren JH. (2007) Bidirectional incompatibility among divergent Wolbachia and incompatibility level differences among closely related Wolbachia in Nasonia. Heredity 99: 278–287. doi: 10.1038/sj.hdy.6800994 [DOI] [PubMed] [Google Scholar]
  14. Bourtzis K, Miller T. (Eds) (2003) Insect Symbiosis. CRC Press, Taylor and Francis Group, LLC, Florida, USA. doi: 10.1201/9780203009918
  15. Bourtzis K, Miller T. (Eds) (2006) Insect Symbiosis 2. CRC Press, Taylor and Francis Group, LLC, Florida, USA.
  16. Bourtzis K, Miller T. (Eds) (2009) Insect Symbiosis 3. CRC Press, Taylor and Francis Group, LLC, Florida, USA.
  17. Bourtzis K, Nirgianaki A, Onyango P, Savakis C. (1994) A prokaryotic dnaA sequence in Drosophila melanogaster: Wolbachia infection and cytoplasmic incompatibility among laboratory strains. Insect Molecular Biology 3: 131–142. doi: 10.1111/j.1365-2583.1994.tb00160.x [DOI] [PubMed] [Google Scholar]
  18. Boykin LM, Schutze MK, Krosch MN, Chomič A, Chapman TA, Englezou A, Armstrong KF, Clarke AR, Hailstones D, Cameron SL. (2014) Multi-gene phylogenetic analysis of south-east Asian pest members of the Bactrocera dorsalis species complex (Diptera: Tephritidae) does not support current taxonomy. Journal of Applied Entomology 138: 235–253. doi: 10.1111/jen.12047 [Google Scholar]
  19. Bush GL, Boller E. (1977) The chromosome morphology of the Rhagoletis cerasi species complex (Diptera, Tephritidae). Annals of the Entomological Society of America 70: 316–318. doi: 10.1093/aesa/70.3.316 [Google Scholar]
  20. Cáceres C, Segura DF, Vera MT, Wornoayporn V, Cladera JL, Teal P, Sapountzis P, Bourtzis K, Zacharopoulou A, Robinson AS. (2009) Incipient speciation revealed in Anastrepha fraterculus (Diptera; Tephritidae) by studies on mating compatibility, sex pheromones, hybridization, and cytology. Biological Journal of the Linnean Society 97: 152–165. doi: 10.1111/j.1095-8312.2008.01193.x [Google Scholar]
  21. Cevallos VE, Nation JL. (2004) Chromosomes of the Caribbean fruit fly (Diptera: Tephritidae). Florida Entomologist 87: 361–364. doi: 10.1653/0015-4040(2004)087[0361:COTCFF]2.0.CO;2 [Google Scholar]
  22. Coats VC, Stack PA, Rumpho ME. (2013) Japanese barberry seed predation by Rhagoletis meigenii fruit flies harboring Wolbachia endosymbionts. Symbiosis 59: 145–156. doi: 10.1007/s13199-013-0223-5 [Google Scholar]
  23. Coscrato VE, Braz ASK, Perondini AL, Selivon D, Marino CL. (2009) Wolbachia in Anastrepha fruit flies (Diptera: Tephritidae). Current Microbiology 59: 295–301. doi: 10.1007/s00284-009-9433-8 [DOI] [PubMed] [Google Scholar]
  24. Doyle JJ, Doyle JL. (1990) Isolation of plant DNA from fresh tissue. Focus 12: 13–15. [Google Scholar]
  25. Drew RAI, Hancock DL. (1994) The Bactrocera dorsalis complex of fruit flies (Diptera: Tephritidae: Dacinae) in Asia. Bulletin of Entomological Research Suppl. 2: 1–69. doi: 10.1017/S1367426900000278 [Google Scholar]
  26. Drew, Romig M. (2013) Tropical Fruit Flies of South-East Asia (Tephritidae: Dacinae). CABI, Wallingford, Oxfordshire.
  27. Drosopoulou E, Augustinos AA, Nakou I, Koeppler K, Kounatidis I, Vogt H, Papadopoulos NT, Bourtzis K, Mavragani-Tsipidou P. (2011a) Genetic and cytogenetic analysis of the American cherry fruit fly, Rhagoletis cingulata (Diptera: Tephritidae). Genetica 139: 1449–1464. doi: 10.1007/s10709-012-9644-y [DOI] [PubMed] [Google Scholar]
  28. Drosopoulou E, Koeppler K, Kounatidis I, Nakou I, Papadopoulos NT, Bourtzis K, Mavragani-Tsipidou P. (2010) Genetic and cytogenetic cnalysis of the Walnut-Husk Fly (Diptera: Tephritidae). Annals of the Entomological Society of America 103: 1003–1011. doi: 10.1603/AN10059 [Google Scholar]
  29. Drosopoulou E, Nakou I, Sichova J, Kubíčková S, Marec F, Mavragani-Tsipidou P. (2012) Sex chromosomes and associated rDNA form a heterochromatic network in the polytene nuclei of Bactrocera oleae (Diptera: Tephritidae). Genetica 140: 169–180. doi: 10.1007/s10709-012-9668-3 [DOI] [PubMed] [Google Scholar]
  30. Drosopoulou E, Nestel D, Nakou I, Kounatidis I, Papadopoulos NT, Bourtzis K, Mavragani-Tsipidou P. (2011b) Cytogenetic analysis of the Ethiopian fruit fly Dacus ciliatus (Diptera: Tephritidae). Genetica 139: 723–732. doi: 10.1007/s10709-011-9575-z [DOI] [PubMed] [Google Scholar]
  31. Duron O, Bouchon D, Boutin S, Bellamy L, Zhou L, Engelstädter J, Hurst GD. (2008a) The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biology 6: 27. doi: 10.1186/1741-7007-6-27 [DOI] [PMC free article] [PubMed]
  32. Duron O, Hurst GDD, Hornett EA, Josling JA, Engelstädter J. (2008b) High incidence of the maternally inherited bacterium Cardinium in spiders. Molecular Ecology 17: 1427–1437. doi: 10.1111/j.1365-294X.2008.03689.x [DOI] [PubMed] [Google Scholar]
  33. Faria R, Navarro A. (2010) Chromosomal speciation revisited: rearranging theory with pieces of evidence. Trends in Ecology and Evolution 25: 660–669. doi: 10.1016/j.tree.2010.07.008 [DOI] [PubMed] [Google Scholar]
  34. Flor M, Hammerstein P, Telschow A. (2007) Wolbachia-induced unidirectional cytoplasmic incompatibility and the stability of infection polymorphism in parapatric host populations. Journal of Evolutionary Biology 20: 696–706. doi: 10.1111/j.1420-9101.2006.01252.x [DOI] [PubMed] [Google Scholar]
  35. Fukatsu T, Nikoh N. (2000) Endosymbiotic microbiota of the bamboo pseudococcid Antonina crawii (Insecta, Homoptera). Applied and Environmental Microbiology 66: 643–650. doi: 10.1128/AEM.66.2.643-650.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Garcia-Martinez V, Hernández-Ortiz E, Zepeta-Cisneros CS, Robinson AS, Zacharopoulou A, Franz G. (2009) Mitotic and polytene chromosome analysis in the Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae). Genome 52: 20–30. doi: 10.1139/G08-099 [DOI] [PubMed] [Google Scholar]
  37. Gilchrist AS, Cameron EC, Sved JA, Meats AW. (2012) Genetic consequences of domestication and mass rearing of pest fruit fly Bactrocera tryoni (Diptera: Tephritidae). Journal of Economic Entomology 136: 252–262. doi: 10.1603/ec11421 [DOI] [PubMed] [Google Scholar]
  38. Goday C, Selivon D, Perondini ALP, Greciano PG, Ruiz MF. (2006) Cytological characterization of sex chromosomes and ribosomal DNA location in Anastrepha species (Diptera, Tephritidae). Cytogenetic and Genome Research 114: 70–76. doi: 10.1159/000091931 [DOI] [PubMed] [Google Scholar]
  39. Gotoh T, Noda H, Ito S. (2007) Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity 98: 13–20. doi: 10.1038/sj.hdy.6800881 [DOI] [PubMed] [Google Scholar]
  40. Hanner R, Fugate M. (1997) Branchiopod phylogenetic reconstruction from 12S rDNA sequence data. Journal of Crustacean Biology 17: 174–183. doi: 10.2307/1549471 [Google Scholar]
  41. Hilgenboecker K, Hammerstein P, Schlattmann P, Telschow A, Werren JH. (2008) How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiology Letters 281: 215–220. doi: 10.1111/j.1574-6968.2008.01110.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Hunwattanakul N, Baimai V. (1994) Mitotic karyotypes of four species of fruit flies (Bactrocera) in Thailand. Kasetsart J. (nat.Sci.) 28: 142–148. [Google Scholar]
  43. Jaenike J, Dyer KA, Cornish C, Minhas MS. (2006) Asymmetrical reinforcement and Wolbachia infection in Drosophila. PLoS Biology 4: e325. doi: 10.1371/journal.pbio.0040325 [DOI] [PMC free article] [PubMed]
  44. Jamnongluk W, Kittayapong P, Baimai V, O’Neill SL. (2002) Wolbachia infections of tephritid fruit flies: Molecular evidence for five distinct strains in a single host species. Current Microbiology 45: 255–260. doi: 10.1007/s00284-002-3746-1 [DOI] [PubMed] [Google Scholar]
  45. Karimi J, Darsouei R. (2014) Presence of the endosymbiont Wolbachia among some fruit flies (Diptera: Tephritidae) from Iran: A multilocus sequence typing approach. Journal of Asia-Pacific Entomology 17: 105–112. doi: 10.1016/j.aspen.2013.11.002 [Google Scholar]
  46. Kirkpatrick M, Barton N. (2006) Chromosome inversions, local adaptation and speciation. Genetics 173: 419–434. doi: 10.1534/genetics.105.047985 [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Kittayapong P, Milne JR, Tigvattananont S, Baimai V. (2000) Distribution of the reproduction-modifying bacteria, Wolbachia, in natural populations of tephritid fruit flies in Thailand. Sci. Asia 26: 93–103. doi: 10.2306/scienceasia1513-1874.2000.26.093 [Google Scholar]
  48. Koukou K, Pavlikaki H, Kilias G, Werren JH, Bourtzis K, Alahiotis SN. (2006) Influence of antibiotic treatment and Wolbachia curing on sexual isolation among Drosophila melanogaster cage populations. Evolution 60: 87. doi: 10.1554/05-374.1 [PubMed]
  49. Kounatidis I, Papadopoulos N, Bourtzis K, Mavragani-Tsipidou P. (2008) Genetic and cytogenetic analysis of the fruit fly Rhagoletis cerasi (Diptera: Tephritidae). Genome 51: 479–491. doi: 10.1139/G08-032 [DOI] [PubMed] [Google Scholar]
  50. Krimbas CB, Powell JR. (1992) Drosophila inversion polymorphism. In: Krimbas CB, Powell JR (Eds) CRC Press, Inc, USA.
  51. Krosch MN, Schutze MK, Armstrong KF, Graham GC, Yeates DK, Clarke AR. (2012) A molecular phylogeny for the Tribe Dacini (Diptera: Tephritidae): systematic and biogeographic implications. Molecular Phylogenetics and Evolution 64: 513–523. doi: 10.1016/j.ympev.2012.05.006 [DOI] [PubMed] [Google Scholar]
  52. Krosch MN, Schutze MK, Armstrong KF, Boontop Y, Boykin LM, Chapman TA, Englezou A, Cameron SL, Clarke AR. (2013) Piecing together an integrative taxonomic puzzle: Microsatellite, wing shape and aedeagus length analyses of Bactrocera dorsalis s. l. (Diptera: Tephritidae) find no evidence of multiple lineages in a proposed contact zone along the Thai/Malay Peninsul. Systematic Entomology: 38: 2–13. doi: 10.1111/j.1365-3113.2012.00643.x [Google Scholar]
  53. Kulathinal RJ, Stevison LS, Noor MAF. (2009) The genomics of speciation in Drosophila: Diversity, divergence, and introgression estimated using low-coverage genome sequencing. Plos Genetics 5. doi: 10.1371/journal.pgen.1000550 [DOI] [PMC free article] [PubMed]
  54. Lee Y, Collier TC, Sanford MR, Marsden CD, Fofana A, Cornel AJ, Lanzaro GC. (2013) Chromosome inversions, genomic differentiation and speciation in the african malaria mosquito Anopheles gambiae. PLoS ONE 8. doi: 10.1371/journal.pone.0057887 [DOI] [PMC free article] [PubMed]
  55. Marcon HS, Coscrato VE, Selivon D, Perondini ALP, Marino CL. (2011) Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (Diptera: Tephritidae). Brazilian Journal of Microbiology 42: 778–785. doi: 10.1590/S1517-83822011000200046 [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Martinez H, Toledo J, Liedo P, Mateos M. (2012) Survey of heritable endosymbionts in southern Mexico populations of the fruit fly species Anastrepha striata and A. ludens. Current Microbiology 65: 711–718. doi: 10.1007/s00284-012-0223-3 [DOI] [PubMed] [Google Scholar]
  57. Mateos M, Castrezana SJ, Nankivell BJ, Estes AM, Markow TA, Moran NA. (2006) Heritable endosymbionts of Drosophila. Genetics 174: 363–376. doi: 10.1534/genetics.106.058818 [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Mavragani-Tsipidou P, Karamanlidou G, Zacharopoulou A, Koliais S, Kastritsis C. (1992) Mitotic and polytene chromosome analysis in Dacus oleae (Diptera: Tephritidae). Genome 35: 373–378. doi: 10.1139/g92-056 [DOI] [PubMed] [Google Scholar]
  59. Mavragani-Tsipidou P, Zacharopoulou A, Drosopoulou E, Augustinos AA, Bourtzis K, Marec F. (2014) Protocols for cytogenetic mapping of insect genomes. Tephritid Fruit Flies. In: Sarakov I (Ed.) CRC Press, Taylor and Francis Group, LLC, 62 pp. [Google Scholar]
  60. McGaugh SE, Noor MAF. (2012) Genomic impacts of chromosomal inversions in parapatric Drosophila species. Philosophical Transactions of the Royal Society B-Biological Sciences 367: 422–429. doi: 10.1098/rstb.2011.0250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Miller WJ, Ehrman L, Schneider D. (2010) Infectious speciation revisited: impact of symbiont-depletion on female fitness and mating behavior of Drosophila paulistorum. PLoS Pathogens 6: e1001214. doi: 10.1371/journal.ppat.1001214 [DOI] [PMC free article] [PubMed]
  62. Morrow JL, Frommer M, Shearman DCA, Riegler M. (2015) The microbiome of field-caught and laboratory adapted australian tephritid fruit fly species with different host plant use and specilisation. Microbial Ecology 70(2): 498–508. doi: 10.1007/s00248-015-0571-1 [DOI] [PubMed] [Google Scholar]
  63. Noor MAF, Grams KL, Bertucci LA, Reiland J. (2001) Chromosomal inversions and the reproductive isolation of species. Proceedings of the National Academy of Sciences of the United States of America 98: 12084–12088. doi: 10.1073/pnas.221274498 [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Parreño MA, Scannapieco AC, Remis MI, Juri M, Vera MT, Segura DF, Cladera JL, Lanvavecchia SB. (2014) Dynamics of genetic variabillity in Anastrepha fraterculus (Diptera: Tephritidae) during adaptation to laboratory rearing conditions. BMC Genetics 15: S14. http://www.biomedcentral.com/1471-2156/15/S2/S14 [DOI] [PMC free article] [PubMed]
  65. Perlman SJ, Hunter MS, Zchori-Fein E. (2006) The emerging diversity of Rickettsia. Proceedings of the Royal Society B: Biological sciences 273: 2097–2106. doi: 10.1098/rspb.2006.354 [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. De Queiroz K. (2007) Species concepts and species delimitation. Systematic Biology 56: 879–886. doi: 10.1080/10635150701701083 [DOI] [PubMed] [Google Scholar]
  67. Ranz JM, Maurin D, Chan YS, von Grotthuss M, Hillier LW, Roote J, Ashburner M, Bergman CM. (2007) Principles of genome evolution in the Drosophila melanogaster species group. PLoS Biology 5: 1366–1381. doi: 10.1371/journal.pbio.0050152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Riegler M, Stauffer C. (2002) Wolbachia infections and superinfections in cytoplasmically incompatible populations of the European cherry fruit fly Rhagoletis cerasi (Diptera, Tephritidae). Molecular Ecology 11: 2425–2434. doi: 10.1046/j.1365-294X.2002.01614.x [DOI] [PubMed] [Google Scholar]
  69. Rieseberg LH. (2001) Chromosomal rearrangements and speciation. Trends in Ecology and Evolution 16: 351–358. doi: 10.1016/S0169-5347(01)02187-5 [DOI] [PubMed] [Google Scholar]
  70. Rocha LS, Mascarenhas RO, Perondini ALP, Selivon D. (2005) Occurunce of Wolbachia in Brazilian samples of Ceratitis capitata (Wiedemann) (Diptera: Tephritidae). Neotropical Entomology 34: 1013–1015. doi: 10.1590/S1519-566X2005000600020 [Google Scholar]
  71. San Jose M, Leblanc L, Geib SM, Rubinoff D. (2013) An Evaluation of the Species Status of Bactrocera invadens and the Systematics of the Bactrocera dorsalis (Diptera: Tephritidae) Complex. Annals of the Entomological Society of America 106: 684–694. doi: 10.1603/AN13017 [Google Scholar]
  72. Saridaki A, Bourtzis K. (2010) Wolbachia: more than just a bug in insects genitals. Current Opinion in Microbiology 13: 67–72. doi: 10.1016/j.mib.2009.11.005 [DOI] [PubMed] [Google Scholar]
  73. Schaeffer SW, Bhutkar AU, McAllister BF, Matsuda M, Matzkin LM, O’Grady PM, Rohde C, Valente VLS, Aguade M, Anderson WW, Edwards K, Garcia ACL, Goodman J, Hartigan J, Kataoka E, Lapoint RT, Lozovsky ER, Machado CA, Noor MAF, Papaceit M, Reed LK, Richards S, Rieger TT, Russo SM, Sato H, Segarra C, Smith DR, Smith TF, Strelets V, Tobari YN, Tomimura Y, Wasserman M, Watts T, Wilson R, Yoshida K, Markow TA, Gelbartt WM, Kaufman TC. (2008) Polytene chromosomal maps of 11 Drosophila species: The order of genomic scaffolds inferred from genetic and physical maps. Genetics 179: 1601–1655. doi: 10.1534/genetics.107.086074 [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Schlick-Steiner BC, Steiner FM, Seifert B, Stauffer C, Christian E, Crozier RH. (2010) Integrative taxonomy: a multisource approach to exploring biodiversity. Annual Review of Entomology 55: 421–438. doi: 10.1146/annurev-ento-112408-085432 [DOI] [PubMed] [Google Scholar]
  75. Schuler H, Arthofer W, Riegler M, Bertheau C, Krumböck S, Köppler K, Vogt H, Teixeira LAF, Stauffer C. (2011) Multiple Wolbachia infections in Rhagoletis pomonella. Entomologia Experimentalis et Applicata 139: 138–144. doi: 10.1111/j.1570-7458.2011.01115.x [Google Scholar]
  76. Schuler H, Bertheau C, Egan SP, Feder JL, Riegler M, Schlick-Steiner BC, Steiner FM, Johannesen J, Kern P, Tuba K, Lakatos F, Köppler K, Arthofer W, Stauffer C. (2013) Evidence for a recent horizontal transmission and spatial spread of Wolbachia from endemic Rhagoletis cerasi (Diptera: Tephritidae) to invasive Rhagoletis cingulata in Europe. Molecular Ecology 22: 4101–4111. doi: 10.1111/mec.12362 [DOI] [PubMed] [Google Scholar]
  77. Schutze MK, Aketarawong N, Amornsak W, Armstrong KF, Augustinos AA, Barr N, Bo W, Bourtzis K, Boykin LM, Cáceres C, Cameron SL, Chapman TA, Chinvinijkul S, Chomič A, De Meyer M, Drosopoulou E, Englezou A, Ekesi S, Gariou-Papalexiou A, Geib SM, Hailstones D, Hasanuzzaman M, Haymer D, Hee AKW, Hendrichs J, Jessup A, Ji Q, Khamis FM, Krosch MN, Leblanc L, Mahmood K, Malacrida AR, Mavragani-Tsipidou P, Mwatawala M, Nishida R, Ono H, Reyes J, Rubinoff D, San Jose M, Shelly TE, Srikachar S, Tan KH, Thanaphum S, Haq I, Vijaysegaran S, Wee SL, Yesmin F, Zacharopoulou A, Clarke AR. (2015) Synonymization of key pest species within the Bactrocera dorsalis species complex (Diptera: Tephritidae): taxonomic changes based on a review of 20 years of integrative morphological, molecular, cytogenetic, behavioural and chemoecological data. Systematic Entomology 40: 456–471. doi: 10.1111/syen.12113 [Google Scholar]
  78. Schutze MK, Jessup A, Ul-Haq I, Vreysen MJB, Wornoayporn V, Vera MT, Clarke AR. (2013) Mating compatibility among four pest members of the Bactrocera dorsalis fruit fly species complex (Diptera: Tephritidae). Journal of Economic Entomology 106: 695–707. doi: 10.1603/EC12409 [DOI] [PubMed] [Google Scholar]
  79. Schutze MK, Krosch MN, Armstrong KF, Chapman TA, Englezou A, Chomič A, Cameron SL, Hailstones D, Clarke AR. (2012) Population structure of Bactrocera dorsalis s.s., B. papayae and B. philippinensis (Diptera: Tephritidae) in southeast Asia: evidence for a single species hypothesis using mitochondrial DNA and wing-shape data. BMC Evolutionary Biology 12: 130. doi: 10.1186/1471-2148-12-130 [DOI] [PMC free article] [PubMed]
  80. Selivon D, Perondini ALP, Ribeiro AF, Marino CL, Lima MMA, Coscrato VE. (2002) Wolbachia endosymbiont in a species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Invertebrate Reproduction & Development 42: 121–127. doi: 10.1080/07924259.2002.9652768 [Google Scholar]
  81. Selivon D, Perondini ALP, Morgante JS. (2005) A genetic - morphological characterization of two cryptic species of the Anastrepha fraterculus complex (Diptera: Tephritidae). Annals of the Entomological Society of America 98: 367–381. doi: 10.1603/0013-8746(2005)098[0367:AGCOTC]2.0.CO;2 [Google Scholar]
  82. Selivon D, Sipula FM, Rocha LS, Perondini ALP. (2007) Karyotype relationships among Anastrepha bistrigata, A. striata and A. serpentina (Diptera, Tephritidae). Genetics and Molecular Biology 30: 1082–1088. doi: 10.1590/S1415-47572007000600009 [Google Scholar]
  83. Stevison LS, Hoehn KB, Noor MAF. (2011) Effects of inversions on within- and between-species recombination and divergence. Genome Biology and Evolution 3: 830–841. doi: 10.1093/gbe/evr081 [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Sturtevant AH, Dobzhansky T. (1936) Inversions in the third chromosome of wild race of Drosophila pseudoobscura, and their use in the study of the history of the species. Proceedings of the National Academy of Sciences of the United States of America 22: 448. doi: 10.1073/pnas.22.7.448 [DOI] [PMC free article] [PubMed]
  85. Sun X, Cui L, Li Z. (2007) Diversity and phylogeny of Wolbachia infecting Bactrocera dorsalis (Diptera: Tephritidae) populations from China. Environmental Entomology 36: 1283–1289. doi: 10.1603/0046-225X(2007)36[1283:DAPOWI]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
  86. Tan KH, Wee SL, Ono H, Nishida R. (2013) Comparison of methyl eugenol metabolites, mitochondrial COI, and rDNA sequences of Bactrocera philippinensis (Diptera: Tephritidae) with those of three other major pest species within the Dorsalis complex. Applied Entomology and Zoology 48: 275–282. doi: 10.1007/s13355-013-0183-5 [Google Scholar]
  87. Telschow A, Flor M, Kobayashi Y, Hammerstein P, Werren JH. (2007) Wolbachia-induced unidirectional cytoplasmic incompatibility and speciation: mainland-island model. PLoS ONE 2: e701. doi: 10.1371/journal.pone.0000701 [DOI] [PMC free article] [PubMed]
  88. Telschow A, Hilgenboecker K, Hammerstein P, Werren JH. (2014) Dobzhansky-Muller and Wolbachia-induced incompatibilities in a diploid genetic system. PLoS ONE 9: e95488. doi: 10.1371/journal.pone.0095488 [DOI] [PMC free article] [PubMed]
  89. Vera MT, Cáceres CE, Wornoayporn V, Islam A, Robinson AS, de La Vega MH, Hendrichs J, Cayol J-P. (2006) Mating incompatibility among populations of the South American fruit fly Anastrepha fraterculus (Diptera: Tephritidae). Annals of the Entomological Society of America 99: 387–397. doi: 10.1603/0013-8746(2006)099[0387:MIAPOT]2.0.CO;2 [Google Scholar]
  90. Virgilio M, Jordaens K, Verwimp C, White IM, De Meyer M. (2015) Higher phylogeny of frugivorous flies (Diptera, Tephritidae, Dacini): Localised partition conflicts and a novel generic classification. Molecular Phylogenetics and Evolution. doi: 10.1016/j.ympev.2015.01.007 [DOI] [PubMed]
  91. Virgilio M, De Meyer M, White IM, Backeljau T. (2009) African Dacus (Diptera: Tephritidae: Molecular data and host plant associations do not corroborate morphology based classifications. Molecular Phylogenetics and Evolution 51: 531–539. doi: 10.1016/j.ympev.2009.01.003 [DOI] [PubMed] [Google Scholar]
  92. Wee SL, Hee AKW, Tan KH. (2002) Comparative sensitivity to and consumption of methyl eugenol in three Bactrocera dorsalis (Diptera: Tephritidae) complex sibling species. Chemoecology 12: 193–197. doi: 10.1007/PL00012668 [Google Scholar]
  93. Werren JH, Baldo L, Clark ME. (2008) Wolbachia: master manipulators of invertebrate biology. Nature Reviews. Microbiology 6: 741–51. doi: 10.1038/nrmicro1969 [DOI] [PubMed] [Google Scholar]
  94. Werren JH, Windsor DM. (2000) Wolbachia infection frequencies in insects: Evidence of a global equilibrium? Proceedings of the Royal Society B: Biological Sciences 267: 1277–1285. doi: 10.1098/rspb.2000.1139 [DOI] [PMC free article] [PubMed]
  95. Yesmin F, Clyde MM. (2012) Identification and characterization of polytene chromosomes of Bactrocera papayae (Diptera: Tephritidae). Malaysian Applied Biology 41: 11–18. [Google Scholar]
  96. Zabalou S, Charlat S, Nirgianaki A, Lachaise D, Merçot H, Bourtzis K. (2004) Natural Wolbachia infections in the Drosophila yakuba species complex do not induce cytoplasmic incompatibility but fully rescue the wRi modification. Genetics 167: 827–834. doi: 10.1534/genetics.103.015990 [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Zacharopoulou A. (1990) Polytene chromosome maps in the medfly Ceratitis capitata. Genome 33: 184–197. [Google Scholar]
  98. Zacharopoulou A, Augustinos AA, Sayed WAA, Robinson AS, Franz G. (2011a) Mitotic and polytene chromosomes analysis of the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). Genetica 139: 79–90. doi: 10.1007/s10709-010-9495-3 [DOI] [PubMed] [Google Scholar]
  99. Zacharopoulou A, Franz G. (2013) Genetic and cytogenetic characterization of Genetic Sexing Strains of Bactrocera dorsalis and Bactrocera cucurbitae (Diptera: Tephritidae). Journal of Economic Entomology 106: 995–1003. doi: 10.1603/EC12379 [DOI] [PubMed] [Google Scholar]
  100. Zacharopoulou A, Sayed WAA, Augustinos AA, Yesmin F, Robinson AS, Franz G. (2011b) Analysis of mitotic and polytene chromosomes and photographic polytene chromosome maps in Bactrocera cucurbitae (Diptera: Tephritidae). Annals of the Entomological Society of America 104: 306–318. doi: 10.1603/AN10113 [Google Scholar]
  101. Zchori-Fein E, Bourtzis K. (Eds) (2011) Manipulative Tenants: Bacteria associated with Arthropods (a volume in the Frontiers in Microbiology Series). CRC Press, Taylor and Francis Group, LLC, Florida, USA.
  102. Zhao JT, Frommer M, Sved JA, Zacharopoulou A. (1998) Mitotic and polytene chromosome analyses in the Queensland fruit fly, Bactrocera tryoni (Diptera: Tephritidae). Genome 41: 510–526. doi: 10.1139/gen-41-4-510 [PubMed] [Google Scholar]
  103. Zug R, Hammerstein P. (2012) Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS ONE 7: e38544. doi: 10.1371/journal.pone.0038544 [DOI] [PMC free article] [PubMed]
  104. Zygouridis NE, Argov Y, Nemny-Lavy E, Augustinos AA, Nestel D, Mathiopoulos KD. (2014) Genetic changes during laboratory domestication of an olive fly SIT strain 138: 423–432. doi: 10.1111/jen.12042

Articles from ZooKeys are provided here courtesy of Pensoft Publishers

RESOURCES