Table 2. PCR primers & assays.

Target name	Assay type	Forward primer sequence	Reverse primer sequence	Notes
k17	Genomic reference	ggcgagagcagagtgtggat	aagtcggcaggcacaggag	Amplifies any mouse genomic DNA
myd88_A	Genomic	cttcctcccagatgaaatcc	tgggaataatggcagtcctc	Amplifies the wild-type allele only (not the conditional nor recombined allele)
myd88_B	Genomic	gttgtgtgtgtccgaccgt	gtcagaaacaaccaccaccatgc	Amplifies the wild-type or conditional allele (not the recombined allele)
cre	Genomic	acatttgggccagctaaacat	cggcatcaacgttttctttt	Generic assay amplifies any allele bearing a cre cassette
mpolr2	Gene expression reference	aagtcggcaggcacaggag	ggcgagagcagagtgtggat	Gene for murine RNA Polymerase II; widely used reference gene for relative gene expression quantification; exon spanning
il1r1	Gene expression	ggagaaatgtcgctggatgt	tttgtgttgttcacggttcg	Not exon spanning
selp	Gene expression	atcgagaccattgggagcta	acactctggcccatagaagc	Exon spanning
tnf	Gene expression	Proprietary commercial assay (Applied Biosystems, Catalog #4331182, TaqMan gene expression assays)		Exon spanning
il1b	Gene expression	Proprietary commercial assay (Applied Biosystems, Catalog #434228, TaqMan gene expression assays)		Exon spanning
ccl2	Gene expression	Proprietary commercial assay (Applied Biosystems, Catalog #443258, TaqMan gene expression assays)		Exon spanning