Table 3. Primer sequences for amplification and sequencing of nuclear phylogeny with models of evolution selected by AIC in Modeltest and Mr.Modeltest.
Primer sequences used to amplify and sequence the cytochrome oxidase I (CO1) gene for the mitochondrial phylogeny and nuclear mitochondrial-like sequence (NuMts) detection and avoidance.
| Locus | Primer | Sequence 5'--->3' | Reference | Model |
|---|---|---|---|---|
| Wingless | LepWG1F | GARTGYAARTGYCAYGGYATGTCTGG | Brower and DeSalle (1998) | GTR + G |
| LepWG2R | ACTICGCRCACCARTGGAATGTRCA | Brower and DeSalle (1998) | ||
| 28s rRNA | M06F | CCCCTGAATTTAAGCATAT | Schmitz and Moritz (1994) | HKY + I |
| 28SCR | CGGTTTCACGTACTCTTGAA | Brady (2003) | ||
| LW Rh | LR-143F | GACAAAGTKCCACCRGARATGC | Ward and Downie (2005) | GTR + G |
| LR672R | CCRCAMGCVGTCATGTTRCCTTC | Ward and Downie (2005) | ||
| Abd-A | AA1172F | CACATCGGCACCGGCGATATGAG | Ward and Downie (2005) | HKY + G |
| AA1881R | GGTTGTTGGCAGGATGTCAAAGG | Ward and Downie (2005) | ||
| CO1 | M13 CI13F | ATAATTTTTTTTATAGTTATACC | Brady (2003) | |
| M13 CI14R | ATTTCTTTTTTTCCTCTTTC | Brady (2003) | ||
| CO1 | JerryF | CAACATTTATTTTGATTTTTTGG | Brady (2003) | |
| Ben3R | GCWACWACRTAATAKGTATCATG | Brady (2003) | ||
| NuMts | LF1F | ATTCAACCAATCATAAAGATATTGG | Smith et al. (2005) | |
| TRL-3382R | TYCAWTGCACTTAWTCTGCCATATTA | P.S. Ward personal communication | ||
| COII-3946R | TATTC ATANCTTCARTATCATTGRTG | P.S. Ward personal communication |