Abstract
Chronic obstructive pulmonary disease (COPD) is characterized by chronic airway inflammation, mucus hypersecretion, and emphysema, which lead to reduced lung function and breathlessness. The pathologies of COPD are due to an abnormal immune response. Invariant natural killer T (iNKT) cells are an important population of innate lymphocytes and have been implicated in the regulation of immune responses associated with a broad range of diseases including COPD. We have here analyzed the role of iNKT cells in a model of COPD induced by repeated intranasal administration of iNKT cell agonist α-galactosylceramide (α-GalCer). Our results demonstrated that mice that received repeated intranasal administration of α-GalCer had molecular and inflammatory features of COPD including airway inflammation with significant increases in infiltration of macrophages and lymphocytes, CD8+ T cells, as well as proinflammatory cytokines IL-6 and TNF-α. In particular, these mice also showed the presence of pulmonary emphysema, mucus production, and pulmonary fibrosis. Furthermore, neutralization of IL-4 reduced α-GalCer induced emphysema. This study indicates the importance of iNKT cells in the pathogenesis of COPD by an IL-4 dependent mechanism.
Introduction
Global burden of human chronic lung diseases, such as asthma and chronic obstructive pulmonary disease (COPD), is increasing gradually. COPD is associated with cigarette smoking and exposure to various environmental pollutants. Viral and bacterial respiratory tract infections are also a risk factor for COPD [1–3]. COPD is characterized by a local inflammatory process manifested by activation of epithelial cells and resident macrophages and elevated levels of inflammatory cytokines such as IL-6, IL-8, and TNF-α [2, 4, 5]. It is associated with formation of mucous exudates within the lumens of small airways and lung parenchymal destruction leading to airspace enlargement [2, 4, 6]. COPD severity is associated with the accumulation of neutrophils, macrophages, natural killer (NK) cells, and T lymphocytes with a preponderance of the CD8+ subtype in the airways [7–9]. Emphysema, characterized by abnormal permanent enlargement of the air spaces, is the most important parameter to assess the presence and severity of COPD [1, 2, 10].
Invariant natural killer T (iNKT) cells are activated by glycolipid, such as α-galactosylceramide (α-GalCer), presented by CD1d. When activated, they produce large amounts of cytokines that can alter the strength and character of immune responses through crosstalk with dendritic cells, neutrophils, and lymphocytes, and by shifting cytokine responses to a T helper 1 (TH1), TH2 or TH17 phenotypes [11–13]. iNKT cells can also be activated by diverse microbial infections which have a profound impact on the development of inflammatory diseases. Microbial glycolipid, such as in Sphingomonas spp and Borrelia burgdorferi, directly activates iNKT cells [14, 15]. Some Toll like receptor (TLR) ligands, such as lipopolysaccharide and CpG, as well as mouse cytomegalovirus and herpes simplex virus 1 activate iNKT cells indirectly through myeloid antigen presenting cells [16–18].
Increased peripheral blood iNKT cells associated with an enhanced expression of the activating marker CD69 have been observed in patients with COPD compared to healthy subjects [19, 20]. In a mouse model of COPD induced by chronic cigarette smoke exposure, increased numbers of activated iNKT cells in the lung were also observed. Several features of COPD (e.g., inflammation and emphysema) were significantly suppressed in Cd1d-/- and Jα18-/- mice lacking iNKT cells [20], indicating a role of iNKT cells. In addition, mouse infected with Sendai virus, a mouse parainfluenza virus, develop long term airway inflammation associated with increased iNKT cells [19].
In this study, we investigated whether and how iNKT cell activation induces COPD-like symptoms. We repeatedly injected an iNKT cell agonist, α-GalCer, to activate lung iNKT cells and analyzed the features of the chronic airway inflammation in these mice. In addition, we studied the mechanism of how iNKT cell activation leads to emphysema. Our results demonstrate that iNKT cell activation induces COPD-like symptoms via IL-4 over-production.
Materials and Methods
Mice and α-GalCer administration
Female BALB/c mice, 6–8 weeks old, were obtained from the National Laboratory Animal Center and housed at the in-house animal care facility of the Animal Center of the College of Medicine, National Taiwan University under a 12 hour day-night-cycle and standardized environment. The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of National Taiwan University, College of Medicine and College of Public Health. Mice were intranasally administered with 2μg α-GalCer (0.2 mg/ml in 0.5% polysorbate 20 in PBS)(Funakoshi, Tokyo, Japan) once a week for 6 weeks. A vehicle control solution was prepared from a solution of 0.5% polysorbate 20 in PBS. Two weeks after the last α-GalCer administration, mice were sacrificed by pentobarbitol (50mg/kg) administration and then cervical dislocation and examined for pathological changes. For IL-4 neutralization, 150 μg of anti-IL-4 antibodies (clone 11B11, BioXcell, Lebanon, NH, USA) were intraperitoneally injected at 1 hour prior to every α-GalCer administration. BALB/c mice, but not C57BL/6 mice, were used in this study because the features of acute and chronic airway inflammation by α-GalCer administration were much higher in BALB/c mice than in C57BL/6 mice.
Analysis of cellular composition and cytokines in the bronchoalveolar lavage fluid (BALF)
Cellular composition in the BALF was assessed as previously described [21]. Cytokines were evaluated by ELISA (Duoset) and chemokines were determined by Dot-blot-based mouse chemokine antibody array (Mouse Cytokine Array Kit) as recommended by the manufacturer (R&D Systems, Minneapolis, MN, USA). Lymphocyte subsets of BALF cells were determined by flow cytometry as previously described [22, 23]. Macrophages were isolated from BALF by adherence method.
Flow cytometry
Cell population and cytokine secretion of iNKT cells were measured by flow cytometry. Before staining cells, with a previously defined optimal dilution of monoclonal antibodies (Abs), the cells were pre-incubated with anti-CD16/32 (clone 93) to block non-specific FcRγ binding. The following Abs were used in this study: anti-CD3, anti-CD4, anti-CD8, and anti-CD49b (Biolegend, San Diego, CA, USA). For intracellular staining, BALF cells were incubated with brefeldin A (10 μg/ml) (BD Biosciences, San Diego, CA, USA) at 37°C for 1 hour then incubated with anti-CD16/32 Abs, followed by staining with PerCP/Cy5.5-conjugated CD3 and PE-conjugated PBS57 loaded CD1d tetramer (originally produced by the NIH tetramer facility, and supplied through Dr. David Serreze), permeabilized with Cytofix/Cytoperm reagent (BD Biosciences), and stained with Alexa Fluor® 488-conjugated anti-IFN-γ (clone XMG1.2), Alexa Fluor® 488-conjugated anti-IL-4 (clone 11B11), or rat IgG1 isotype control (clone R3-34) (BD Biosciences). Stained cells were assessed on a FACSCalibur (BD Biosciences) using FlowJo softwares (Tree Star, Inc., Ashland, OR, USA).
Measurements of pulmonary function
Pulmonary function was measured by measuring the changes of airway resistance, dynamic compliance, and airway elastance in response to increasing doses of aerosolized methacholine (3.125–12.5 mg/ml) (Sigma-Aldrich) using a Buxco Pulmonary Mechanics System (Buxco Electronics, Wilmington, NC). Mice were anesthetized, tracheostomized, and mechanically ventilated at a rate of 150 breaths/min, a tidal volume of 0.3ml, and a positive end-expiratory pressure of 3–4 cmH2O with a computer-controlled small animal ventilator. Pulmonary parameters were recorded for 3 minutes after 3-minute exposure of aerosol methacholine and analyzed by BioSystem XA software.
Tissue preparation
Lungs were perfused with PBS through the right ventricle to remove blood from the vascular bed. Ten percent buffered formalin solution was instilled through the tracheal cannula at a constant pressure of 20 cmH2O to inflate and fix the lung. Specimens were immersed in 10% buffered formalin solution overnight and dehydrated in a graded series of ethanol solutions. Tissue was embedded in paraffin, and sections were cut at 5-μm thickness for hematoxylin and eosin (H&E) staining, periodic acid-Schiff (PAS) staining and Massion’s trichrome staining for the examination of pulmonary morphometry, mucus production, and fibrosis.
Morphometric analysis
For mean linear intercept (MLI) analysis, digital images of airways were acquired with a microscope and imported into MetaMorph® Imaging System software version 7.7 (Universal Imaging Corp., Downingtown, PA, USA). Briefly, a series of grid lines was laid over each photomicrograph to determine the number of times those lines were intercepted by alveolar tissue, with Lm = L/Li, where L was the total length of the lines in the grid field and Li was the total number of times those lines were intercepted.
MMP12 detection in cytokine stimulated bone marrow–derived macrophages (BM-Mϕ)
Bone marrow cells from femurs and tibias of BALB/c mice were incubated with 20% L929 conditioned medium for 7 days to allow differentiation and maturation of macrophages. The purity of macrophages stained with anti-Ly6G and anti-F4/80 antibodies and determined by flow cytometry (Ly6G-F4/80+) and cell morphology was ≥ 99%. BM-Mϕ were stimulated with different concentrations of IL-4 and IFN-γ for 18 hours. Cells were collected for RNA extraction and expression of Mmp12 was analyzed by qRT-PCR.
Quantitative real time RT-PCR analysis
Total RNA was isolated from liver tissue using Trizol reagent (Invitrogen Life Technologies). Total RNA was reverse transcribed to cDNA with random primers using the Reverse Transcription System kit following manufacturer’s instructions (Thermo Scientific Fermentas, Rockford, IL, USA). PCR was performed on a 7500 Fast Real-Time PCR System (Applied Biosystems). SYBR Green DNA-binding dye was used in the amplification reactions. Fluorescence signals were analyzed during each cycle (pre-treatment 2 minute at 50°C, initial denaturation 10 minute at 95°C and denaturation 15 seconds at 95°C and annealing/extension 1 minute at 60°C for 40 cycles). Data were normalized to internal β-actin expression. The primers used in the qPCR assay are listed in Table 1.
Table 1. Primers used in this study.
Oligo Name | Sequence | |
---|---|---|
β-actin | Forward | 5'-CACAGTGTTGTCTGGTGGTA -3' |
Reverse | 5'-GACTCATCGTACTCCTGCTT -3' | |
Muc5ac | Forward | 5'-AGAATATCTTTCAGGACCCCTGCT -3' |
Reverse | 5'-ACACCAGTGCTGAGCATACTTTT -3' | |
collagen III | Forward | 5'- GTTCTAGAGGATGGCTGTACTAAACACA -3' |
Reverse | 5'-TTGCCTTGCGTGTTTGATATTC -3' | |
IL-6 | Forward | 5'-CTCTGGGAAATCGTGGAAATG -3' |
Reverse | 5'-AAGTGCATCATCGTTGTTCATACA -3' | |
TNF-α | Forward | 5'-CCCCAAAGGGATGAGAAGTTC -3' |
Reverse | 5'-TGAGGGTCTGGGCCATAGAA -3' | |
MMP-12 | Forward | 5’-GAAACCCCCATCCTTGACAA-3’ |
Reverse | 5’-TTCCACCAGAAGAACCAGTCTTTAA-3’ |
Statistical analysis
Data are presented as mean ± SEM. Statistical analysis was performed with GraphPad Prism (GraphPad Software). Data were analyzed by Kruskal-Wallis one-way ANOVA followed Dunn's post test and by Mann-Whitney U test. *, p<0.05; **, p<0.01; ***, p<0.001 were considered to be statistically significant.
Results
Intranasal α-GalCer administration activates iNKT cells and induces acute airway inflammation
In our previous study, we found intranasal administration of α-GalCer, the most studied glycolipid that activates iNKT cells, induced cytokine production and airway inflammation within hours in wild-type mice but not in iNKT cell deficient CD1d knockout mice [21]. To get a better understanding of iNKT cell mediated airway inflammation, we carried out detailed analyses of immunological changes induced by a single intranasal α-GalCer administration. Two hours after α-GalCer administration, the numbers of BALF iNKT (CD3+CD1d tetramer +) cells were increased (Fig 1A) and they produced IFN-γ and IL-4 (Fig 1B). In addition, IFN-γ and IL-4 in the bronchoalveolar lavage fluid (BALF) were increased in mice administered with α-GalCer (Fig 1C).
We then analyzed the airway inflammation at 3 and 7 days after α-GalCer administration. BALF total cells were increased. Among them, macrophages and lymphocytes were gradually increasing after α-GalCer administration; nerutophils were increased at 3 days but trended down at 7 days; eosinophils were slightly increased at 3 days (Fig 2A). With cytokine and chemokine array assay, we found enhanced expression of several cytokines and chemokines in the BALF at 3 days after α-GalCer administration while undetectable at day 0 (Fig 2B and data not shown). IFN-γ and IL-4 were highly expressed at 3 days and back to baseline at 7 days after α-GalCer administration. TNF-α and IL-17 were slightly increased at 3 days after α-GalCer administration. IL-13 was not increased (Fig 2C). Taken together, these results combined with our previous data suggested that α-GalCer administration activated iNKT cells to secrete cytokines such as IL-4 and IFN-γ which then recruited inflammatory cells including neutrophils, lymphocytes and macrophages to the lung in wild type mice.
Decreased lung function and increased airway inflammation in mice repeated intranasally administered with α-GalCer
To understand the role of lung iNKT cells in the pathogenesis of chronic lung disease, mice were intranasally administered with α-GalCer once a week for 6 weeks and features of chronic airway inflammation were examined at 2 weeks after the last administration. Mice repeated intranasally administered with α-GalCer did not have abnormal appearance and behavior (data not shown). As shown in Fig 3A, a decline of lung function including increased airway resistance, reduced dynamic complicance, and increased airway elastance was observed in mice repeatedly administered with α-GalCer. Histological examination of H&E-stained lung tissue sections of mice repeatedly administered with α-GalCer demonstrated apparent cell infiltration in the lung. Aggregates appeared to be located around the airways. These cell infiltrates were not found in lungs of vehicle-treated controls (Fig 3B). BALF total cells were significantly increased in mice repeatedly administered with α-GalCer (Fig 3C). Among them, macrophages and lymphocytes were significantly increased (Fig 3D). Both CD4+ and CD8+ T cells were increased in α-GalCer administered mice (Fig 3E) with an increased CD8/CD4 ratio (Fig 3F), suggesting a preponderance of the CD8+ subtype in T cells. Proinflammatory cytokines, TNF-α and IL-6, in the lung of α-GalCer administered mice were increased compared to those of vehicle administered mice (Fig 3G). In addition, increased expression of TNF-α and IL-6 was also noted in macrophages from the BALF of α-GalCer administered mice (Fig 3H).
Pulmonary emphysema, mucus production, and fibrosis in mice receiving repeated intranasal administration of α-GalCer
Emphysema is a pulmonary disease characterized by abnormal permanent enlargement of the air spaces accompanied by destruction of the alveolar walls, which is the most important parameter to assess the presence and severity of COPD [1, 2, 10]. The mean linear intercept (Lm) is a measure of the surface area to volume ratio and is the most commonly reported metric of emphysema [24]. As shown in Fig 3A, the enlargement of the air space was clearly observed in α-GalCer administered mice compared to vehicle-treated control. In addition, significantly increased mean linear intercept (Lm) in the lung tissue of α-GalCer administered mice was noted compared to the vehicle-treated mice (45.07 μm±2.57 vs 41.27 μm±1.77, p<0.01) (Fig 4A). Matrix metalloproteinases (MMP)-12 is an important proteinase in the development of emphysema [25]. It is secreted as a 54 kDa inactive pro-enzyme, which is activated by proteolytic cleavage of the prodomain followed by processing into an active enzyme of 45 kDa and then a 22 kDa [26]. MMP12 protein and mRNA were also significantly increased in lung tissues of α-GalCer administered mice (Fig 4B and 4C). In addition, increased expression of MMP12 was also noted in macrophages from the BALF of α-GalCer administered mice (Fig 4D). We then examined mucus production of the lung tissue. Positive PAS staining mucus producing cells were found only in α-GalCer administered mice but not in the vehicle-treated control (Fig 4E). Furthermore, the expression of Muc5ac in the lung of the α-GalCer administered mice was significantly higher than that in vehicle treated mice (Fig 4F). α-GalCer administered mice also exhibited mild lung fibrosis as highlighted by Massion’s trichrome staining (Fig 4G). Of note, collagen III was significantly increased in α-GalCer administered mice (Fig 4H).
IL-4 enhanced MMP12 production in macrophages
We then studied the mechanism of how repeated α-GalCer administration led to emphysema. We hypothesized that the IFN-γ and/or IL-4 production by activated iNKT cells enhanced MMP12 expression and the development of emphysema. As MMP-12 is mainly expressed by macrophages [27], we first investigated whether IFN-γ and/or IL-4 affected MMP12 expression in macrophages. This was done by stimulating bone marrow derived macrophages with IL-4 or IFN-γ and measuring their Mmp12 expression. The results showed that IL-4 was a potent inducer of Mmp12 mRNA expression, whereas IFN-γ slightly downregulated Mmp12 mRNA expression in bone marrow derived macrophages (Fig 5).
IL-4 neutralization reduced α-GalCer induced emphysema
We then studied whether IL-4 in the α-GalCer induced COPD-like symptom model increased MMP12 expression and enlarged airway space. We administered mice with neutralizing antibodies to IL-4 one hour prior to every α-GalCer administration. Two weeks after the last administration, mice were analyzed for features of COPD. As shown in Fig 6A, Mmp12 expression in lung was significantly reduced in mice treated with anti-IL-4 Abs. Mmp12 expression in macrophages was also reduced in mice treated with anti-IL-4 Abs (Fig 6B). In addition, the mean linear intercept was significantly reduced in anti-IL-4 Abs treated α-GalCer administered mice than in isotype Abs-treated mice (Fig 6C). Lymphocytes in the BALF were significantly decreased in α-GalCer administered mice that were also treated with anti-IL-4 Abs while the numbers of macrophages were not changed (Fig 6D). Furthermore, the expression of Muc5ac in the lung of the anti-IL-4 Abs treated mice was lower than isotype Abs treated mice (Fig 6E). These results suggested that IL-4 contributed to the pathogenesis of iNKT cell induced COPD-like symptoms.
Discussion
In this study, we showed that repeated intranasal α-GalCer administration induced airway inflammation in mice. Total inflammatory cells in the BALF were increased in mice repeatedly administered with α-GalCer. Among them, macrophages and lymphocytes were significantly increased. Importantly, increased CD8+ T cells were observed in repeatedly α-GalCer administered mice. In addition, increased proinflammatory cytokines, mucus production, airspace enlargement, and pulmonary fibrosis were also noted in mice with repeated intranasal α-GalCer administration. All of these features in repeatedly α-GalCer administered mice were similar to pathological hallmarks of COPD. Furthermore, neutralization of IL-4 reduced α-GalCer induced emphysema. Collectively, these data suggested that chronic activation of iNKT cells in the airways lead to IL-4 mediated COPD-like symptoms.
In human COPD, increased numbers of neutrophils, macrophages and lymphocytes and elevated levels of numerous inflammatory cytokines such as IL-6, IL-8, and TNF-α are noted in the lungs of patients [2, 4, 5, 7]. It is suggested that release of proinflammatory cytokines and chemokines by airway epithelial cells and alveolar macrophages elicits the recruitment of neutrophils, macrophages and lymphocytes to the lungs [2, 4, 5]. Activated neutrophils and macrophages cause lung destruction through the release of oxygen radicals and proteolytic enzymes such as matrix metalloproteinases (MMPs), including MMP-12 [28]. Mice lacking MMP-12 are completely protected against emphysema [25].
Previously, we and others showed that α-GalCer administration before OVA immunization increases serum levels of IgE, Th2 cytokines, airway hyperreactivity (AHR), and airway eosinophilia after OVA rechallenging in the OVA-alum immunized murine model of allergic asthma [21, 29–31]. In patients with COPD, the frequency of activated iNKT cells is increased compared to controls [19, 20]. In mice chronically exposed to cigarette smoke, activated iNKT cells accumulate in the lungs and significantly contribute to the pathogenesis of COPD [20]. Importantly, Kim et al. show that viral infection induces chronic airway inflammation which is driven by macrophages and requires the presence of iNKT cells, suggesting that iNKT cells activated by virus infection induce alternative activation of macrophages, which then drive chronic lung disease [19]. These results combined with ours suggest that iNKT cell activation is critical in the development of chronic lung diseases including asthma and COPD.
In this study, we showed that mice repeatedly administered with α-GalCer produced high levels of IL-4 and features of COPD. Administration of anti-IL-4 Abs was found to reduce MMP12 expression and emphysema in α-GalCer administered mice. These results suggest a critical role of IL-4 in the pathogenesis of iNKT cell activation induced COPD. Upregulation of IL-4 has been documented in emphysematous human lung tissues [32] and cigarette smoke-exposed murine lungs [33]. Although the studies of IL-4 in COPD are limited, our results show that IL-4 can enhance the production of MMP12 and lung destruction.
In this study, Mmp12 mRNA expression in α-GalCer administered mice had a 10-fold increase in lung tissue but it is only increased by 2-fold in macrophage. MMP-12 is dominantly produced by macrophages; however, other cells such as human airway smooth muscle cells also express and secrete MMP-12 [34]. Although Mmp12 mRNA expression in the lung tissue of the α-GalCer administered mice was upregulated by 10-fold, the protein levels of the 54 kDa latent form and the 45 kDa active form were only increased by 1.2-fold. These results were similar to previous studies on MMP-12 release by macrophages and smooth muscle cells [27, 34]. The difference in levels of mRNA and protein suggests a complex regulation of MMP-12 translation and secretion. Otherwise, it could be due to the timing of sample collection.
To further study the mechanisms of human COPD, animal models have to be established. Cigarette smoke exposure to mice is the most frequently used animal model of COPD. However, the induction of either emphysema or small airway remodeling in cigarette smoke induced COPD model requires more than 6 months of smoke exposure [35]. In this study, we showed that it requires only 6 weeks to induce a COPD like airway inflammation in mice by repeated administration with α-GalCer, and thus provide an alternative approach to study this disease.
In conclusion, repeated activation of iNKT cells by α-GalCer administration in the airways can lead to chronic lung disease similar to human COPD. This study demonstrates a role of iNKT cell activation in chronic airway inflammatory disease and repeated airway α-GalCer administration can be used as a new model for the study of COPD.
Acknowledgments
We thank Dr. D. Serreze for providing the CD1d-tetramer staining reagent. We thank the staff of the imaging core at the First Core Labs, National Taiwan University College of Medicine, for technical assistance.
Abbreviations
- α-GalCer
α-galactosylceramide
- BALF
bronchoalveolar lavage fluid
- COPD
chronic obstructive pulmonary disease
- iNKT
Invariant natural killer T
- MMP
matrix metalloproteinases
Data Availability
All relevant data are within the paper.
Funding Statement
This work was supported by grants from the Ministry of Science and Technology, Taiwan, NSC 97-2320-B-002-017-MY3 and NSC 100-2320-B-002-086- (YHC).
References
- 1.Barnes PJ. Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol. 2008;8(3):183–92. Epub 2008/02/16. nri2254 [pii] 10.1038/nri2254 . [DOI] [PubMed] [Google Scholar]
- 2.Brusselle GG, Joos GF, Bracke KR. New insights into the immunology of chronic obstructive pulmonary disease. Lancet. 2011;378(9795):1015–26. Epub 2011/09/13. 10.1016/S0140-6736(11)60988-4 . [DOI] [PubMed] [Google Scholar]
- 3.Halbert RJ, Natoli JL, Gano A, Badamgarav E, Buist AS, Mannino DM. Global burden of COPD: systematic review and meta-analysis. Eur Respir J. 2006;28(3):523–32. Epub 2006/04/14. 10.1183/09031936.06.00124605 . [DOI] [PubMed] [Google Scholar]
- 4.Provinciali M, Cardelli M, Marchegiani F. Inflammation, chronic obstructive pulmonary disease and aging. Current opinion in pulmonary medicine. 2011;17 Suppl 1:S3–10. Epub 2012/01/11. 10.1097/01.mcp.0000410742.90463.1f. . [DOI] [PubMed] [Google Scholar]
- 5.Barnes PJ. The cytokine network in asthma and chronic obstructive pulmonary disease. J Clin Invest. 2008;118(11):3546–56. Epub 2008/11/05. 10.1172/JCI36130 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Young HW, Williams OW, Chandra D, Bellinghausen LK, Perez G, Suarez A, et al. Central role of Muc5ac expression in mucous metaplasia and its regulation by conserved 5' elements. Am J Respir Cell Mol Biol. 2007;37(3):273–90. Epub 2007/04/28. 2005-0460OC [pii] 10.1165/rcmb.2005-0460OC [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.O'Shaughnessy TC, Ansari TW, Barnes NC, Jeffery PK. Inflammation in bronchial biopsies of subjects with chronic bronchitis: inverse relationship of CD8+ T lymphocytes with FEV1. American journal of respiratory and critical care medicine. 1997;155(3):852–7. Epub 1997/03/01. . [DOI] [PubMed] [Google Scholar]
- 8.Urbanowicz RA, Lamb JR, Todd I, Corne JM, Fairclough LC. Enhanced effector function of cytotoxic cells in the induced sputum of COPD patients. Respir Res. 2010;11:76 Epub 2010/06/15. 1465-9921-11-76 [pii] 10.1186/1465-9921-11-76 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Saetta M, Di Stefano A, Turato G, Facchini FM, Corbino L, Mapp CE, et al. CD8+ T-lymphocytes in peripheral airways of smokers with chronic obstructive pulmonary disease. American journal of respiratory and critical care medicine. 1998;157(3 Pt 1):822–6. Epub 1998/03/28. . [DOI] [PubMed] [Google Scholar]
- 10.Turato G, Zuin R, Saetta M. Pathogenesis and pathology of COPD. Respiration. 2001;68(2):117–28. Epub 2001/04/05. 50478 [pii] 50478. . [DOI] [PubMed] [Google Scholar]
- 11.Godfrey DI, Kronenberg M. Going both ways: immune regulation via CD1d-dependent NKT cells. J Clin Invest. 2004;114(10):1379–88. . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Godfrey DI, MacDonald HR, Kronenberg M, Smyth MJ, Van Kaer L. NKT cells: what's in a name? Nat Rev Immunol. 2004;4(3):231–7. . [DOI] [PubMed] [Google Scholar]
- 13.Kronenberg M. Toward an understanding of NKT cell biology: progress and paradoxes. Annu Rev Immunol. 2005;23:877–900. . [DOI] [PubMed] [Google Scholar]
- 14.Kinjo Y, Wu D, Kim G, Xing GW, Poles MA, Ho DD, et al. Recognition of bacterial glycosphingolipids by natural killer T cells. Nature. 2005;434(7032):520–5. Epub 2005/03/26. nature03407 [pii] 10.1038/nature03407 . [DOI] [PubMed] [Google Scholar]
- 15.Mattner J, Debord KL, Ismail N, Goff RD, Cantu C 3rd, Zhou D, et al. Exogenous and endogenous glycolipid antigens activate NKT cells during microbial infections. Nature. 2005;434(7032):525–9. Epub 2005/03/26. nature03408 [pii] 10.1038/nature03408 . [DOI] [PubMed] [Google Scholar]
- 16.Nagarajan NA, Kronenberg M. Invariant NKT cells amplify the innate immune response to lipopolysaccharide. J Immunol. 2007;178(5):2706–13. Epub 2007/02/22. 178/5/2706 [pii]. . [DOI] [PubMed] [Google Scholar]
- 17.Paget C, Mallevaey T, Speak AO, Torres D, Fontaine J, Sheehan KC, et al. Activation of invariant NKT cells by toll-like receptor 9-stimulated dendritic cells requires type I interferon and charged glycosphingolipids. Immunity. 2007;27(4):597–609. Epub 2007/10/24. S1074-7613(07)00450-5 [pii] 10.1016/j.immuni.2007.08.017 . [DOI] [PubMed] [Google Scholar]
- 18.Tyznik AJ, Tupin E, Nagarajan NA, Her MJ, Benedict CA, Kronenberg M. Cutting edge: the mechanism of invariant NKT cell responses to viral danger signals. J Immunol. 2008;181(7):4452–6. Epub 2008/09/20. 181/7/4452 [pii]. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kim EY, Battaile JT, Patel AC, You Y, Agapov E, Grayson MH, et al. Persistent activation of an innate immune response translates respiratory viral infection into chronic lung disease. Nat Med. 2008;14(6):633–40. Epub 2008/05/20. 10.1038/nm1770 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Pichavant M, Remy G, Bekaert S, Le Rouzic O, Kervoaze G, Vilain E, et al. Oxidative stress-mediated iNKT-cell activation is involved in COPD pathogenesis. Mucosal immunology. 2014;7(3):568–78. 10.1038/mi.2013.75 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Chuang YH, Wang TC, Jen HY, Yu AL, Chiang BL. alpha-Galactosylceramide-induced airway eosinophilia is mediated through the activation of NKT cells. J Immunol. 2011;186(8):4687–92. Epub 2011/03/09. 10.4049/jimmunol.1003659 . [DOI] [PubMed] [Google Scholar]
- 22.Chang CH, Chen YC, Zhang W, Leung PS, Gershwin ME, Chuang YH. Innate immunity drives the initiation of a murine model of primary biliary cirrhosis. PLoS One. 2015;10(3):e0121320 10.1371/journal.pone.0121320 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Lin PY, Jen HY, Chiang BL, Sheu F, Chuang YH. Interleukin-21 suppresses the differentiation and functions of T helper 2 cells. Immunology. 2015;144(4):668–76. 10.1111/imm.12419 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Thurlbeck WM. Measurement of pulmonary emphysema. Am Rev Respir Dis. 1967;95(5):752–64. Epub 1967/05/01. . [DOI] [PubMed] [Google Scholar]
- 25.Hautamaki RD, Kobayashi DK, Senior RM, Shapiro SD. Requirement for macrophage elastase for cigarette smoke-induced emphysema in mice. Science. 1997;277(5334):2002–4. Epub 1997/09/26. . [DOI] [PubMed] [Google Scholar]
- 26.Atkinson JJ, Lutey BA, Suzuki Y, Toennies HM, Kelley DG, Kobayashi DK, et al. The role of matrix metalloproteinase-9 in cigarette smoke-induced emphysema. American journal of respiratory and critical care medicine. 2011;183(7):876–84. Epub 2010/11/09. 10.1164/rccm.201005-0718OC [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Wu L, Fan J, Matsumoto S, Watanabe T. Induction and regulation of matrix metalloproteinase-12 by cytokines and CD40 signaling in monocyte/macrophages. Biochemical and biophysical research communications. 2000;269(3):808–15. 10.1006/bbrc.2000.2368 . [DOI] [PubMed] [Google Scholar]
- 28.Demedts IK, Morel-Montero A, Lebecque S, Pacheco Y, Cataldo D, Joos GF, et al. Elevated MMP-12 protein levels in induced sputum from patients with COPD. Thorax. 2006;61(3):196–201. Epub 2005/11/26. 10.1136/thx.2005.042432 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Akbari O, Faul JL, Hoyte EG, Berry GJ, Wahlstrom J, Kronenberg M, et al. CD4+ invariant T-cell-receptor+ natural killer T cells in bronchial asthma. The New England journal of medicine. 2006;354(11):1117–29. Epub 2006/03/17. 10.1056/NEJMoa053614 . [DOI] [PubMed] [Google Scholar]
- 30.Akbari O, Stock P, Meyer E, Kronenberg M, Sidobre S, Nakayama T, et al. Essential role of NKT cells producing IL-4 and IL-13 in the development of allergen-induced airway hyperreactivity. Nat Med. 2003;9(5):582–8. Epub 2003/04/02. 10.1038/nm851 . [DOI] [PubMed] [Google Scholar]
- 31.Meyer EH, Goya S, Akbari O, Berry GJ, Savage PB, Kronenberg M, et al. Glycolipid activation of invariant T cell receptor+ NK T cells is sufficient to induce airway hyperreactivity independent of conventional CD4+ T cells. Proceedings of the National Academy of Sciences of the United States of America. 2006;103(8):2782–7. Epub 2006/02/16. 10.1073/pnas.0510282103 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Jeffery PK. Differences and similarities between chronic obstructive pulmonary disease and asthma. Clinical and experimental allergy: journal of the British Society for Allergy and Clinical Immunology. 1999;29 Suppl 2:14–26. . [PubMed] [Google Scholar]
- 33.Bartalesi B, Cavarra E, Fineschi S, Lucattelli M, Lunghi B, Martorana PA, et al. Different lung responses to cigarette smoke in two strains of mice sensitive to oxidants. Eur Respir J. 2005;25(1):15–22. 10.1183/09031936.04.00067204 . [DOI] [PubMed] [Google Scholar]
- 34.Xie S, Issa R, Sukkar MB, Oltmanns U, Bhavsar PK, Papi A, et al. Induction and regulation of matrix metalloproteinase-12 in human airway smooth muscle cells. Respir Res. 2005;6:148 10.1186/1465-9921-6-148 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Wright JL, Cosio M, Churg A. Animal models of chronic obstructive pulmonary disease. American journal of physiology Lung cellular and molecular physiology. 2008;295(1):L1–15. Epub 2008/05/06. 10.1152/ajplung.90200.2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All relevant data are within the paper.