Table 2.
Attachment site analysis and resistance profile of the ICESa2603 family.
| ICEs name | % Identity to Int2603 | % Identity to rplL2603 | attB (3) | Putative att sites | Resistance profile |
|---|---|---|---|---|---|
| ICESa2603 | 100 | 100 | rplL | TTATTTAAGAGTAAC | Hg, Cd, Cu |
| ICESde3396 | 100 | – | – | – | Cd, Cu, As |
| ICESdy12394-1 | 100 | 84 | rplL | TTATTTAAGAGTGAT | Cd, Cu |
| ICESpa43144-1 | 96 | 84 | hypothetical protein | TTATTTAAGAGTAAC | |
| ICESthJIM8232-1 | 96 | 88 | rplL | TTATTTAAGAGTAAC | |
| ICESa09mas018883 | 81 | 99 | rplL | TTATTTAAGAGTAAC | |
| ICESsu32457 | 99 | –a | rplL | TTATTTAAGAGTAAC | erm(B), aadE, aphA, tet(40), tet(O/W/32/O) |
| ICESsu05ZYH33-1 | 96 | 84 | rplL | TTATTTAAGAGTAAC | tet(M), aadE |
| ICESsu98HAH33-1 | 96 | 84 | rplL | TTATTTAAGAGTAAC | tet(M), aadE |
| ICESsuSC84 | 96 | 84 | rplL | TTATTTAAGAGTAAC | tet(M), aadE |
| ICESsuBM407-2 | 96 | 84 | rplL | TTATTTAAGAGTAAC | tet(M), tet(L), tet(O), erm(B), aadE, cat |
| ICESsuD9 | 99 | 84 | rplL | TTATTTAAGAGTAAC | tet(O), erm(B) |
| ICESsuSS12 | 96 | 84 | rplL | TTATTTAAGAGTAAC | tet(O), erm(B) |
| ICESsuT15b | – | 84 | SSU0877 in S. suis P1/7 | CCTCTTATGTCAAGTAACTG (attL) CATTATTATGACACAATCCC (attR) | |
| ICESluvanb | – | –a | rumA | CACGTGGAGTGCGTAGTGTT (attL) TTCTCAAGGACCAGACAACA (attR) | van resistance operon |
| ICESsuHB1011c | 98 | – | rplL | TTATTTAAGAGTAAC | tet(O), erm(B) |
a
The rplL sequences were not indicated.
b
The ICESsuT15 and ICESluvan's Int belonging to serine recombinase (SR) family shared low homology with the ICESa2603 tyrosine family site-specific integrase. ICESluvan was inserted in rum, and the att site was experimentally confirmed by Bjorkeng et al. (2013). ICESsuT15 was inserted in the 344 sites of SSU0877 in S. suis P1/7, the putative att site was predicted, and the Int of ICESsuT15 and ICESluvan may recognize CA dinucleotide in certain region of chromosome sites.
c
ICESsuHB1011 sequence was not complete and the rplL sequences were not known.