Table 1.
Dissociation (KD) and single-turnover rate constants (kobs) for PRORP2 with (nu)pre-tRNAGly substrates containing varying 5′ leader and 3′ trailer lengths. The data were measured in buffers containing 30 mM MOPS pH 7.8, 150 mM NaCl, 1 mM DTT and 1 mM MgCl2 (kobs) or CaCl2 (KD). The standard error values displayed were obtained from at least three independent experiments.
| Nuclear Substrate | 5′ leader sequence | 3′ trailer sequence | KD (nM) | kobs (min−1) |
|---|---|---|---|---|
| pre-tRNAGly 23:10 | GGGUAUUUGCUCGAUAUGCAAAA | UUUAUAUUUU | 118 ± 26 | 0.7 ±0.1 |
| pre-tRNAGly 23:5 | GGGUAUUUGCUCGAUAUGCAAAA | UUUAU | 52 ± 12 | 1.0 ±0.1 |
| pre-tRNAGly 23:1 | GGGUAUUUGCUCGAUAUGCAAAA | U | 17 ± 5 | 0.7 ±0.1 |
| pre-tRNAGly 13:1 | GGGAUAUGCAAA | U | 6 ± 1 | 0.7 ±0.1 |
| pre-tRNAGly 8:1 | GGGCAAAA | U | 3 ± 1 | 1.1 ±0.1 |