Abstract
Objective. We compared laboratory developed real-time PCR assays for detection of Mycoplasma hominis and for detection and differentiation of Ureaplasma urealyticum and parvum to culture using genitourinary specimens submitted for M. hominis and Ureaplasma culture. Methods. 283 genitourinary specimens received in the clinical bacteriology laboratory for M. hominis and Ureaplasma species culture were evaluated. Nucleic acids were extracted using the Total Nucleic Acid Kit on the MagNA Pure 2.0. 5 μL of the extracts were combined with 15 μL of each of the two master mixes. Assays were performed on the LightCycler 480 II system. Culture was performed using routine methods. Results. M. hominis PCR detected 38/42 M. hominis culture-positive specimens, as well as 2 that were culture negative (sensitivity, 90.5%; specificity, 99.2%). Ureaplasma PCR detected 139/144 Ureaplasma culture-positive specimens, as well as 9 that were culture negative (sensitivity, 96.5%; specificity, 93.6%). Of the specimens that tested positive for Ureaplasma species, U. urealyticum alone was detected in 33, U. parvum alone in 109, and both in 6. Conclusion. The described PCR assays are rapid alternatives to culture for detection of M. hominis and Ureaplasma species, and, unlike culture, the Ureaplasma assay easily distinguishes U. urealyticum from parvum.
1. Introduction
Mycoplasma hominis, Ureaplasma urealyticum, and Ureaplasma parvum are small, fastidious bacteria belonging to the Mollicutes class. They lack a cell wall (preventing staining with Gram stain) and are not sensitively detected on routine bacterial cultures. Optimal recovery requires specialized media and growth conditions. There are several human pathogens in the genera Mycoplasma and Ureaplasma which are responsible for a variety of clinical manifestations involving multiple body systems [1]. M. hominis causes septic arthritis and postpartum fever and has been associated with pelvic inflammatory disease and bacterial vaginosis [2]. Ureaplasma species can cause acute urethritis and have been associated with bacterial vaginosis, preterm birth, and neonatal respiratory disease [1, 3].
Although M. hominis and Ureaplasma species can be cultured, this requires technical skill for interpretation of microscopic colonies and takes two to five days. U. urealyticum was the only Ureaplasma species until 2002, when U. parvum was described [4]. The two are not distinguished based on culture characteristics alone. Real-time PCR detection of these microorganisms from clinical samples circumvents technical issues related to culture and shortens turn-around time for detection and identification.
Few real-time PCR assays and associated studies have been described for M. hominis. A real-time PCR assay targeting M. hominis gap identified two positive cervical swabs from women being evaluated for infertility [5]. 153 urogenital specimens were tested with a real-time PCR assay targeting M. hominis yidC, of which 45 were PCR- and culture positive and 10 PCR positive only [6]. Finally, extragenital M. hominis infection was diagnosed in three patients using a real-time PCR assay targeting the M. hominis 16S ribosomal RNA gene [7].
There has been more work on real-time PCR assays for Ureaplasma species, although some have described assays but have not evaluated clinical specimens or clinical isolates [8]. A real-time PCR assay that detects and distinguishes U. urealyticum from parvum was described but used to assess 87 vaginal swabs [9]. Tang et al. used a real-time PCR assay that detects and distinguishes U. parvum and urealyticum to test 346 genitourinary swabs; 120 were positive for the former and 21 for the latter, including 5 positive for both [10]. Finally, Vancutsem et al. used a real-time PCR assay for detection and differentiation of U. urealyticum and parvum to evaluate 300 lower genital tract specimens; 132 were culture positive, of which all plus an additional 19 were PCR-positive (19, U. urealyticum; 120, U. parvum; 12, Ureaplasma species) [11].
Herein, we present one real-time PCR assay for the detection of M. hominis and another for the detection and differentiation of Ureaplasma species and report results of these assays on 283 genitourinary specimens in comparison to culture.
2. Materials and Methods
2.1. Clinical Specimens
283 genitourinary specimens (swabs, urine) submitted to the Mayo Clinic Clinical Microbiology Laboratory in transport medium (e.g., UTM, M5) for M. hominis and Ureaplasma culture were evaluated. No clinical data associated with these specimens was available. This study was approved by the Mayo Clinic Institutional Review Board.
2.2. Mycoplasma hominis Culture
Samples were placed into arginine broth, incubated at 35°C, and monitored four times daily for up to five days. Color change (indicating an alkaline pH shift) in the arginine broth prompted subculture of 50 μL to an A7 agar plate. Plates were incubated anaerobically at 35°C for up to five days and examined daily with an inverted light microscope for “fried egg” morphology colonies.
2.3. Ureaplasma Culture
Samples were placed into U9 broth, incubated at 35°C, and monitored four times daily for up to five days. A color change (indicating an alkaline pH shift) in the U9 broth prompted subculture of 100 μL to an A7 agar plate. Plates were incubated anaerobically at 35°C for up to 48 hours and examined with an inverted light microscope for small, circular to irregular colonies growing into the surface of the agar, with a surrounding red zone. Confirmation of Ureaplasma species was indicated by golden-brown stained colonies with the addition of 0.167 M CO(NH2)2 and 0.04 M MnCl2 in water.
2.4. Sample Processing for PCR
Samples were vortexed and 200 μL transferred to a MagNA Pure sample cartridge (Roche Applied Science, Indianapolis, IN). DNA extraction was performed on the MagNA Pure LC 2.0 using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Applied Science) with a final elution volume of 100 μL.
2.5. Polymerase Chain Reaction Assay
Primers and probes (Table 1) were designed using the LightCycler Probe Design Software, version 2.0 (Roche Diagnostics, Indianapolis, IN, USA) and DNA Workbench, version 5.7.1 (CLC Bio, Cambridge, MA, USA). Positive control plasmids were constructed for the three target-specific genes (Table 1) using the pCR 2.1 TOPO TA Cloning Kit (Invitrogen Corporation, Carlsbad, CA, USA). Sources for the inserted target sequences were M. hominis ATCC 23114, U. urealyticum ATCC 27618, and U. parvum ATCC 27815D. Plasmids were purified using the High Pure Plasmid Isolation Kit (Roche Applied Science). Sizes of the cloned inserts were confirmed by EcoR1 digestion. Plasmid inserts were sequenced using M13 forward and reverse primers included in the cloning kit, to confirm proper insert orientation. Plasmids were diluted in Tris-EDTA buffer (pH 8.0) and stored at 4°C.
Table 1.
Primers and probes.
| Mycoplasma hominis tuf (set number 793, TIB MolBio, Aldelphia, NJ; 10X concentration)a | ||
|---|---|---|
| Primers | tuf 193F | 5′ AATTGATATGTTTAAAGATGATGAAAGAGA 3′ |
| tuf 193R | 5′ TGTATCAACAGCATCCATTAATTCC 3′ | |
| Probes | tuf 193flb | 5′ GACGTAAGAAGCCTTCTATCAGAATATGGT FITC 3′ |
| tuf 193iLC610c | 5′ Red610 TGATGGTGACAATGCTCCTATTATTGCTGGTTC PO4 3′ | |
|
| ||
| Ureaplasma species ureC (set number 684, TIB MolBio; 10X concentration)d | ||
|
| ||
| ureC 158F | 5′ CCTGCTTCGTTTAATGTATCTG 3′ | |
| Primers | ureC 158R | 5′ GAAGATCCAATCTTTGAACAAATCGTA 3′ |
| ureC 158R5 | 5′ GAAGATCCAATCTTTGAACAAATTGCT 3′ | |
| Probes | ureC 158flb | 5′ AGCAACTGTTAATGCTAAGTCAATAGCGTTTCCTG FITC 3′ |
| ureC 158iLC610c | 5′ Red610 GCCCCTCAGTCTTCGTGAATCTTAAGACCACAAGC PO4 3′ | |
The two assays were independently optimized on the LightCycler 480 II platform employing LightCycler 480 Software version 1.5 (Roche Applied Science). 15 μL of PCR master mix, containing final concentrations of 1X Roche Genotyping Master (Taq DNA polymerase, PCR reaction buffer, deoxyribonucleoside triphosphate with dUTP substituted for dTTP and 1 mM MgCl2), 1 mM (additional) MgCl2, and 1X of each of the LightCycler primer-probe sets (Table 1) were added to a 96-well LightCycler 480 plate. Extracted nucleic acid (5 μL) was then added to each well. The cycling program was as follows: denaturation at 95°C for 10 min; amplification for 45 cycles of 10 s at 95°C, 15 s at 55°C (single acquisition), and 15 s at 72°C; melting curve analysis for 30 s at 95°C, 10 s at 59°C, 15 s at 45°C (ramp rate of 0.1°C/s), and 0 s at 80°C (ramp rate of 0.14°C/s and continuous acquisition); and cooling for 30 s at 40°C. Positive and negative controls were included in each run. The positive control consisted of the abovementioned plasmids in S.T.A.R. buffer : sterile water (1 : 1) at a concentration of 1,000 targets/μL. The negative control consisted of 1,000 colony forming units of Escherichia coli ATCC 25922 S.T.A.R. buffer : sterile water (1 : 1) at a concentration of 1,000 targets/μL.
2.6. Polymerase Chain Reaction Sensitivity and Specificity
Predicted amplified product, primer, and probe sequences were subjected to BLAST searches using the National Center for Biotechnology Information (NCBI) genomic database (http://www.ncbi.nlm.nih.gov/). Analytical sensitivity was assessed by spiking a series of six tenfold dilutions of quantified genomic DNA from M. hominis ATCC 23114, U. urealyticum ATCC 27816, and U. parvum ATCC 27815D into genitourinary samples. Each dilution was extracted in triplicate and each extract was assayed in duplicate. The limit of detection was the lowest dilution where all six replicates were detected. Inclusivity and cross-reactivity were assessed using a panel organisms (Table 2), including 16 members of the Mollicutes class.
Table 2.
Cross-reactivity and inclusivity panel. Only Mycoplasma hominis, Ureaplasma parvum, and Ureaplasma urealyticum were detected (by the appropriate assays).
| Organism | Accession no. or source | Organism | Accession no. or source |
|---|---|---|---|
| Acholeplasma laidlawii | ATCC 23206 | Entamoeba histolytica | ATCC 30459 |
| Acinetobacter baumannii | ATCC 19606 | Entamoeba moshkovskii | ATCC 30042 |
| Acinetobacter lwoffii/haemolyticus | QC Strain | Enterobacter cloacae | ATCC 13047 |
| Actinomyces odontolyticus | ATCC 17929 | Enterococcus faecalis | ATCC19433U |
| Aeromonas hydrophila | CAP-D-1-82 | Enterococcus faecium | ATCC 19434 |
| Arcanobacterium haemolyticum | ATCC 9345 | Escherichia coli | ATCC 25922 |
| Arcanobacterium pyogenes | ATCC 19411 | Escherichia coli O142:K86(B):H6 | ATCC 23985 |
| Parabacteroides distasonis | ATCC 8503 | Escherichia coli O157:H7 | ATCC 35150 |
| Bacteroides fragilis | ATCC 25285 | Escherichia coli O70:K:H42 | ATCC 23533 |
| Bacteroides thetaiotaomicron | ATCC 29741 | Escherichia fergusonii | ATCC 35469 |
| Bacteroides vulgatus | ATCC 29327 | Escherichia hermannii | ATCC 33650 |
| Bifidobacterium adolescentis | ATCC 15703 | Escherichia vulneris | ATCC 33821 |
| Bifidobacterium bifidum | ATCC 29521 | Eubacterium rectale | ATCC 33656 |
| Bordetella bronchiseptica | ATCC 19395 | Finegoldia magna | ATCC 29328 |
| Bordetella holmesii | ATCC 51541 | Fluoribacter bozemanae | ATCC 33217 |
| Bordetella parapertussis | ATCC 15311 | Fluoribacter gormanii | ATCC 33297 |
| Bordetella pertussis | ATCC 9797 | Fusobacterium nucleatum | ATCC 25559 |
| Burkholderia cepacia | SCB1277 | Gardnerella vaginalis | NYS 4-87 |
| Campylobacter coli | ATCC 33559 | Giardia lamblia | ATCC 30957 |
| Campylobacter jejuni | ATCC 33560 | Haemophilus influenzae | ATCC 10211 |
| Chlamydia trachomatis | ATCC VR-348B | Human DNA | MRC-5 cells |
| Chlamydophila pneumoniae | ATCC 53592 | Klebsiella oxytoca | ATCC 700324 |
| Chlamydophila pneumoniae | ATCC VR-1310 | Klebsiella pneumoniae | ATCC 700603 |
| Citrobacter freundii | ATCC 8090 | Lactobacillus delbrueckii ssp. lactis | ATCC 12315 |
| Clostridium difficile | ATCC 9689 | Lactobacillus rhamnosus | ATCC 7469 |
| Clostridium perfringens | ATCC 13124 | Fluoribacter dumoffii | ATCC 33279 |
| Clostridium ramosum | ATCC 25582 | Legionella jordanis | ATCC 33623 |
| Collinsella aerofaciens | ATCC 25986 | Legionella longbeachae | ATCC 33462 |
| Corynebacterium diphtheriae | SCB-25-86 | Tatlockia micdadei | ATCC 33204 |
| Corynebacterium pseudodiphtheria | NY-4-88 | Legionella pneumophila | ATCC 33152 |
| Cryptosporidium species | feline isolate | Legionella wadsworthii | ATCC 33877 |
| Dientamoeba fragilis | ATCC 30948 | Listeria monocytogenes | ATCC 15313 |
| Eggerthella lenta | ATCC 25559 | Moraxella catarrhalis | ATCC 8176 |
| Encephalitozoon cuniculi | JS strain | Morganella morganii | CAP-D-5-79 |
| Encephalitozoon hellem | ATCC 50451 | Mycobacterium africanum | ATCC 25420 |
| Encephalitozoon intestinalis | ATCC 50651 | Mycobacterium avium | ATCC 700398 |
| Mycobacterium avium | ATCC 700897 | Proteus mirabilis | ATCC 35659 |
| Mycobacterium bovis | ATCC 19210 | Proteus vulgaris | QC strain |
| Mycobacterium bovis (BCG) | ATCC 35735 | Pseudomonas aeruginosa | ATCC 27853 |
| Mycobacterium gordonae | ATCC 14470 | Pseudomonas fluorescens/putida | CDC-AB4-B10-84 |
| Mycobacterium intracellulare | ATCC 35761 | Rhodococcus equi | ATCC 6939 |
| Mycobacterium kansasii | ATCC 12478 | Salmonella enterica | ATCC 35987 |
| Mycobacterium microti | ATCC 19422 | Salmonella serogroup B | CAP-D-1-69 |
| Mycobacterium smegmatis | ATCC 19980 | Shigella dysenteriae | CDC 82-002-72 |
| Mycobacterium tuberculosis | ATCC 25177 | Shigella flexneri serotype 2a | ATCC29903 |
| Mycobacterium tuberculosis | ATCC 27294 | Shigella sonnei | ATCC 25931 |
| Mycobacterium tuberculosis | ATCC 35825 | Staphylococcus aureus | ATCC 25923 |
| Mycobacterium tuberculosis | ATCC 35837 | Staphylococcus epidermidis | ATCC 14990 |
| Mycoplasma arginini | ATCC 23838D | Stenotrophomonas maltophilia | SCB-33-77 |
| Mycoplasma arthritidis | ATCC 19611D | Streptococcus bovis | CAP-D-16-83 |
| Mycoplasma bovis | ATCC 25523D | Streptococcus pneumoniae | ATCC 49619 |
| Mycoplasma buccale | ATCC 23636 | Streptococcus pyogenes | ATCC 19615 |
| Mycoplasma faucium | ATCC 25293 | Streptococcus sanguinis | ATCC 10556 |
| Mycoplasma fermentans | ATCC 19989 | ∗ Ureaplasma parvum | ATCC 28715 |
| Mycoplasma genitalium | ATTC 33530 | ∗ Ureaplasma urealyticum | ATCC 27618 |
| ∗ Mycoplasma hominis | ATCC 23114 | Yersinia enterocolitica | ATCC 9610 |
| Mycoplasma hyorhinis | ATCC 17981D | BK polyomavirus | ATCC VR-837 |
| Mycoplasma lipophilum | ATCC 27104 | Cytomegalovirus | ATCC VR-538 |
| Mycoplasma orale | ATCC 23714 | ||
| Mycoplasma phocidae | ATCC 33657 | Herpes simplex virus 1 | Lab Control |
| Mycoplasma pirum | ATCC 25960D | Herpes simplex virus 2 | Lab Control |
| Mycoplasma pneumoniae | ATCC 15531D | Human adenovirus 9 | ATCC VR-1086 |
| Mycoplasma salivarium | ATCC 23064 | Human coronavirus 229E | ATCC VR-740 |
| Neisseria gonorrhoeae | ATCC 43069 | Human coxsackievirus B 1 (Enterovirus) | ATCC VR-28 |
| Neisseria lactamica | ATCC 23970 | Human herpesvirus 6B | ATCC VR-1467 |
| Neisseria meningitidis | ATCC 13077 | Human herpesvirus 7 | ABI 08765000 |
| Nocardia brasiliensis | ATCC 51512 | Human herpesvirus 8 | ABI 08735000 |
| Nocardia brevicatena | ATCC 15333 | Human parainfluenza virus 1 | ATCC VR-94 |
| Nocardia carnea | ATCC 6847 | Human parainfluenza virus 3 | ATCC VR-93 |
| Nocardiopsis dassonvillei | ATCC 23218 | Respiratory syncytial virus A2 | ATCC VR-1540 |
| Nocardia farcinica | ATCC 3318 | Respiratory syncytial virus B | ATCC VR-1401 |
| Nocardia otitidiscaviarum | ATCC 14629 | Influenza A virus (H3N2) | ATCC VR-810 |
| Nocardia transvalensis | ATCC 6865 | Influenza B virus | ATCC VR-791 |
| Plesiomonas shigelloides | ATCC 14029 | Measles virus | ATCC VR-24 |
| Porphyromonas gingivalis | ATCC 33277 | Mumps virus | ATCC VR-365 |
| Prevotella melaninogenica | ATCC 25845 | Varicella-zoster virus | ATCC VR-1367 |
| Prevotella oralis | ATCC 33269 |
Clinical sensitivity and specificity were assessed by assaying the aforementioned clinical specimens and comparing results to those of culture. Discordant samples were tested courtesy of Dr. Stellrecht, at an independent clinical laboratory (Albany Medical Center) with a previously described assay [12].
The ability of the Ureaplasma assay to differentiate urealyticum from parvum was assessed as follows. Cultured isolates from clinical samples were directly subjected to PCR with species differentiation based on melting curve analysis; sequence variations underlying the probed regions of U. urealyticum and parvum result in separation of the melting temperature of the two species (Figures 1 and 2). Results were compared to those of a previously described conventional PCR speciation method targeting the multiple-banded antigen using primers UMS-57 and UMA222 for U. parvum and UMS-170 and UMA263 for U. urealyticum [13].
Figure 1.
Melting curves of Ureaplasma urealyticum and Ureaplasma parvum.
Figure 2.
Ureaplasma probe design.
2.7. Statistical Analysis
Assessment of the assays' sensitivity and specificity, with associated 95% confidence intervals (CI), compared to that of culture for M. hominis and Ureaplasma species was made using SAS software version 9.1 (SAS, INC, Cary, NC, USA).
3. Results
3.1. Polymerase Chain Reaction Sensitivity and Specificity
The analytical sensitivity of both assays was 100 genome copies/μL genitourinary specimen. Amplified product, primer, and probe sequences were subjected to NCBI database searches using BLAST software; no significant homology was noted outside of the genera targeted by these assays. Nucleic acid material from members of the Mollicutes class, excluding M. hominis and the Ureaplasma species, was not detected (Table 2).
3.2. Clinical Sensitivity and Specificity
The M. hominis PCR assay had a clinical sensitivity and specificity of 90.7% (95% CI: 77.4%, 97.3%) and 99.2% (95% CI: 97.0%, 99.9%), respectively (Table 3). The 6 discordant results were tested at the Albany Medical Center using an assay targeting the 16S ribosomal RNA gene; [12] both PCR positive/culture-negative specimens were PCR positive, and three of four PCR negative/culture-positive specimens were PCR negative.
Table 3.
Comparison of PCR with culture for Mycoplasma hominis and Ureaplasma species detection.
| M. hominis culture | ||||
|---|---|---|---|---|
| Positive | Negative | |||
| M. hominis PCR | Positive | 38 | 2 | 40 |
| Negative | 4 | 239 | 243 | |
| 42 | 241 | 283 | ||
|
| ||||
| Sensitivity = 90.5% (95% CI: 77.4%, 97.3%), specificity = 99.2% (95% CI: 97.0%, 99.9%) | ||||
|
| ||||
| Ureaplasma species culture | ||||
| Positive | Negative | |||
|
| ||||
| Ureaplasma PCR | Positive | 1391 | 92 | 148 |
| Negative | 5 | 130 | 135 | |
| 144 | 139 | 283 | ||
|
| ||||
| Sensitivity = 96.5% (95% CI: 92.1%, 98.9%), specificity = 93.5% (95% CI: 88.1%, 97.0%) | ||||
1 U. urealyticum (n = 28), U. parvum (n = 109), U. urealyticum and U. parvum (2).
2 U. urealyticum (n = 3), U. parvum (n = 6).
The Ureaplasma PCR assay had a clinical sensitivity and specificity of 96.5% (95% CI: 92.1%, 98.9%) and 93.8% (95% CI: 88.1%, 97.0%), respectively (Table 3). The 14 discordant results were tested at Albany Medical Center; [12] five of nine specimens that were PCR positive/culture negative were PCR positive, and all five specimens that were PCR negative/culture positive were PCR negative. Of the specimens that tested positive for Ureaplasma species by PCR and were culture positive, U. urealyticum alone was detected in 28, U. parvum alone in 109, and both in 2. Among the PCR positive/culture-negative specimens, U. urealyticum was detected in 3 and U. parvum in 6.
Thirty-one culture isolates of Ureaplasma species were tested with the Ureaplasma assay and a previously reported PCR method that differentiates between the two species [13]. The reference method yielded species-level identification for 20 isolates, including 4 U. urealyticum and 16 U. parvum, with identical results to the assay described herein. The remaining 11 isolates were speciated by the assay described herein but not by the reference method; they were confirmed to be Ureaplasma species by partial 16S ribosomal RNA gene sequencing [14]. All partial 16S ribosomal RNA gene sequences were identical to one another and were perfect matches to bases 145,365 through 145,845 of GenBank AF222894.1 (U. parvum) and bases 40 through 520 of GenBank L08642.1 (U. urealyticum).
4. Discussion
We describe two rapid real-time PCR assays, one for detection of M. hominis and the other for detection of Ureaplasma species; they have comparable performance to culture but yield results in three hours, instead of two to five days for culture. These assays are performed on a standard platform and are adaptable to automation, a potential advantage over other described methods, especially for large reference laboratories that process large numbers of specimens.
We are not aware of other real-time PCR studies that have assessed M. hominis and Ureaplasma species using the same set of clinical samples. Overall, 14% of tested specimens were PCR positive for M. hominis and 52% for Ureaplasma species. A multiplex PCR enzyme-linked immunosorbent assay was used to detect M. hominis and U. parvum and urealyticum in cervical swabs from 175 Australian women with and without cervicitis; 16% tested positive for M. hominis and 68% for Ureaplasma species [15]. Multiplex PCR and autocapillary electrophoresis were used to detect M. hominis and Ureaplasma species (without differentiating U. parvum from urealyticum) in genitourinary specimens from 113 South Koreans with sexually transmitted infections; 12% were positive for M. hominis and 43% for Ureaplasma species [16]. These findings are similar to ours [15, 16].
Our PCR assay not only detects Ureaplasma species but also differentiates U. parvum from urealyticum. As in prior studies, U. parvum was more common than U. urealyticum, [10, 11, 15, 17] with 41% of the genitourinary specimens testing positive for the former and 12% for the latter. In one prior study, 63% of specimens were positive for U. parvum and 7% for U. urealyticum [15]. Another study showed, using a multiplex PCR-reverse line blot assay, that 48% of first voided urine specimens from women attending sexual health clinics in Australia were positive for U. parvum and 25% for U. urealyticum [17]. In the study by Tang et al., 36% of genitourinary swabs collected from hospitalized males and females in China were positive for U. parvum and 8% for U. urealyticum [10]. Finally, in study by Vancutsem et al., 44% of lower genital tract specimens obtained from healthy women at their first prenatal visit in Belgium were positive for U. parvum and 10% for U. urealyticum [11]. Despite different geographic locales and clinical status, these numbers are strikingly similar.
In addition to the advantage of speed, the described assays overcome the challenges of detection of these organisms by culture. Although culture is considered a gold standard method (and was so considered in this study), colonial identification is challenging and subjective because it is done using the human eye and a dissecting microscope. Artifacts may be misidentified as colonies, yielding false-positive results, or colonies may be overlooked, yielding false-negative results. Although PCR may be considered more technically complex, in a laboratory where technologists are familiar with PCR, this approach is more user-friendly (and generalizable among assays for various microorganisms) than culture.
The described assays may be useful for investigating epidemiology and pathogenesis of infections with U. parvum and urealyticum [2, 18]. Although extra-genital specimens were not tested, the described M. hominis assay may be useful to detect extra-genital M. hominis infections [7].
Acknowledgments
The authors thank Emily A. Vetter and Daniel R. Gustafson for their thoughtful reviews of this paper and assistance with the described studies and Dr. Kathleen A. Stellrecht at the Albany Medical Center for assistance with testing of discrepant results. This work was presented in part at the 48th Annual Infectious Diseases Society of America Meeting, 2010.
References
- 1.Taylor-Robinson D., Jensen J. S. Mycoplasma genitalium: from chrysalis to multicolored butterfly. Clinical Microbiology Reviews. 2011;24(3):498–514. doi: 10.1128/CMR.00006-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Patel M. A., Nyirjesy P. Role of Mycoplasma and Ureaplasma species in female lower genital tract infections. Current Infectious Disease Reports. 2010;12(6):417–422. doi: 10.1007/s11908-010-0136-x. [DOI] [PubMed] [Google Scholar]
- 3.Aaltonen R., Jalava J., Laurikainen E., Kärkkäinen U., Alanen A. Cervical Ureaplasma urealyticum colonization: comparison of PCR and culture for its detection and association with preterm birth. Scandinavian Journal of Infectious Diseases. 2002;34(1):35–40. doi: 10.1080/00365540110077074. [DOI] [PubMed] [Google Scholar]
- 4.Robertson J. A., Stemke G. W., Davis J. W., et al. Proposal of Ureaplas maparvum sp. nov. and emended description of Ureaplasma urealyticum (Shepard et al. 1974) Robertson et al. 2001. International Journal of Systematic and Evolutionary Microbiology. 2002;52(2):587–597. doi: 10.1099/00207713-52-2-587. [DOI] [PubMed] [Google Scholar]
- 5.Baczynska A., Svenstrup H. F., Fedder J., Birkelund S., Christiansen G. Development of real-time PCR for detection of Mycoplasma hominis . BMC Microbiology. 2004;4(article 35) doi: 10.1186/1471-2180-4-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Férandon C., Peuchant O., Janis C., et al. Development of a real-time PCR targeting the yidC gene for the detection of Mycoplasma hominis and comparison with quantitative culture. Clinical Microbiology and Infection. 2011;17(2):155–159. doi: 10.1111/j.1469-0691.2010.03217.x. [DOI] [PubMed] [Google Scholar]
- 7.Pascual A., Jaton K., Ninet B., Bille J., Greub G. New diagnostic real-time PCR for specific detection of Mycoplasma hominis DNA. International Journal of Microbiology. 2010;2010:4. doi: 10.1155/2010/317512.317512 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Xiao L., Glass J. I., Paralanov V., et al. Detection and characterization of human Ureaplasma species and serovars by real-time PCR. Journal of Clinical Microbiology. 2010;48(8):2715–2723. doi: 10.1128/JCM.01877-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yi J., Bo H. Y., Kim E. C. Detection and biovar discrimination of Ureaplasma urealyticum by real-time PCR. Molecular and Cellular Probes. 2005;19(4):255–260. doi: 10.1016/j.mcp.2005.04.002. [DOI] [PubMed] [Google Scholar]
- 10.Tang J., Zhou L., Liu X., Zhang C., Zhao Y., Wang Y. Novel multiplex real-time PCR system using the SNP technology for the simultaneous diagnosis of Chlamydia trachomatis, Ureaplasma parvum and Ureaplasma urealyticum and genetic typing of serovars of C. trachomatis and U. parvum in NGU. Molecular and Cellular Probes. 2011;25(1):55–59. doi: 10.1016/j.mcp.2010.12.001. [DOI] [PubMed] [Google Scholar]
- 11.Vancutsem E., Soetens O., Breugelmans M., Foulon W., Naessens A. Modified real-time PCR for detecting, differentiating, and quantifying Ureaplasma urealyticum and Ureaplasma parvum . Journal of Molecular Diagnostics. 2011;13(2):206–212. doi: 10.1016/j.jmoldx.2010.10.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Stellrecht K. A., Woron A. M., Mishrik N. G., Venezia R. A. Comparison of multiplex PCR assay with culture for detection of genital mycoplasmas. Journal of Clinical Microbiology. 2004;42(4):1528–1533. doi: 10.1128/JCM.42.4.1528-1533.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Kong F., Ma Z., James G., Gordon S., Gilbert G. L. Species identification and subtyping of Ureaplasma parvum and Ureaplasma urealyticum using PCR-based assays. Journal of Clinical Microbiology. 2000;38(3):1175–1179. doi: 10.1128/jcm.38.3.1175-1179.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Baracaldo T., Foltzer M., Patel R., Bourbeau P. Empyema caused by Mycoplasma salivarium . Journal of Clinical Microbiology. 2012;50(5):1805–1806. doi: 10.1128/JCM.06839-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.McIver C. J., Rismanto N., Smith C., et al. Multiplex PCR testing detection of higher-than-expected rates of cervical Mycoplasma, Ureaplasma, and Trichomonas and viral agent infections in sexually active australian women. Journal of Clinical Microbiology. 2009;47(5):1358–1363. doi: 10.1128/JCM.01873-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Samra Z., Rosenberg S., Madar-Shapiro L. Direct simultaneous detection of 6 sexually transmitted pathogens from clinical specimens by multiplex polymerase chain reaction and auto-capillary electrophoresis. Diagnostic Microbiology and Infectious Disease. 2011;70(1):17–21. doi: 10.1016/j.diagmicrobio.2010.12.001. [DOI] [PubMed] [Google Scholar]
- 17.McKechnie M. L., Hillman R. J., Jones R., et al. The prevalence of urogenital micro-organisms detected by a multiplex PCR-reverse line blot assay in women attending three sexual health clinics in Sydney, Australia. Journal of Medical Microbiology. 2011;60(7):1010–1016. doi: 10.1099/jmm.0.029108-0. [DOI] [PubMed] [Google Scholar]
- 18.Barykova LD Y. A., Shmarov M. M., Vinarov A. Z., et al. Association of Mycoplasma hominis infection with prostate cancer. Oncotarget. 2011;2(4):289–297. doi: 10.18632/oncotarget.256. [DOI] [PMC free article] [PubMed] [Google Scholar]