Table 1.

Details of the recombinant P. ovis antigens used in the vaccine cocktail

P. ovis antigen	Accession No.	Reference	Soluble in PBS a	Molecular weight (kDa) b	Expression system
Cathepsin L	BQ834906.1	[23]	No	25	E. coli BL21-Codon Plus—pET-22b(+)
muGST	AM991140.1	[14]	Yes	25	E. coli BL21-Codon Plus—pET-22b(+)
Pso o 1	AM269885.1	[21]	Yes	25	P. pastoris-X-33-pPICZαC
Pso o 2	AF187083.1	[24]	No	14	E. coli BL21-Codon Plus—pET-22b(+)
Pso o 3	c	d, e	No	25	E. coli BL21-Codon Plus—pET-22b(+)
Pso o 10	AM114276.1	[20]	Yes	37	E. coli BL21-Codon Plus—pET-22b(+)
Cyclophilin	AAP03083.1	d, f	Yes	38	E. coli BL21-Codon Plus—pET-SUMO

^aPso o 1, Pso o 10, cyclophilin and muGST were soluble in PBS, whilst Pso o 2, Pso o 3 and cathepsin L were formulated in Dialysis Buffer (DB).

^bPredicted molecular weight in kilo Daltons.

^cNot yet assigned.

^dUnpublished data.

^ePso o 3 identified as a homologue of the house dust mite allergen Der p 3 in an EST from a P. ovis cDNA library. The following primer sequences were used to amplify the coding region of Pso o 3, from cDNA derived from mixed stage P. ovis as described in [20], downstream of the predicted signal peptide sequence, and to allow subcloning into the expression vector (restriction sites underlined) :Pso o 3-For 5′ GATCCGAATTCGGCATATCGAATGTTTCCACTTCC3′, Pso o 3-Rev-5′ CCGCAAGCTTTACGATTCCGACAATCGTTTTAC3′.

^f P. ovis cyclophilin identified as an EST from a P. ovis cDNA library. The following primer sequences were used to amplify full length P. ovis cyclophilin from cDNA derived from mixed stage P. ovis as described in [20] : Cyclophilin-For 5′ATGTCAACATGGACCCAAATTCAA′3, Cyclophilin-Rev 5′TTACATTTCACCACATTGTGATATGAT3′. Cyclophilin was subsequently expressed in E. coli, confirmed by matrix assisted laser desorption ionisation mass spectroscopy and its peptidyl prolyl cis–trans isomerase (PPIase) activity confirmed by a coupled enzyme assay as described in [41].