Table 1.

Primers, primer sequences, and cycling conditions used in the 16S rDNA and 16S–23S ITS PCR reactions.

Assay	Primer name	Primer Sequence (5′-3′)	Annealing temperature (Ta)	Cycling Conditions
16S rDNA PCR	Sphingo 108f	GCGTAACGCGTGGGAATCTG	62° C	95° C→5 min; 50 cycles of 95°C→5 s,62°C→10 s,
	Sphingo 420r	TTACAACCCTAAGGCCTTC		74°C→30 s, and 74°C →2 min
16S–23S ITS PCR	16S–1511f	AAGTCGTAACAAGGTARCCG	60° C	95° C→12 min; 30 cycles of 94° C→30 s,
	23S–23r	YYGCCAAGGCATCCACC		60°C→30 s, 72°C→1 min, and 72°C→10 min
	1492f	AAGTCGTAACAAGGTAACC
	115r	GGGTTBCCCCATTCRG