Skip to main content
. 2016 Feb 13;6:11. doi: 10.1186/s13578-016-0078-6

Table 1.

Analysed genes and information about sequences of primers, product size and used probes for real-time PCR

Gene description Gene name Primer left (5′–3′) Primer right (5′–3′) Product size (bp) UPL probe
Glyceraldehyd-3-phosphate dehydrogenase GAPDH gctctctgctcctcctgttc acgaccaaatccgttgactc 115 # 60
Aggrecan ACAN tgcagctgtcactgtagaaactt atagcaggggatggtgagg 112 # 79
Collagen, type I, alpha 1 COL1A1 atgttcagctttgtggacctc ctgtacgcaggtgattggtg 126 # 15
Collagen, type II, alpha 1 COL2A1 ccctggtcttggtggaaac tccttgcattactcccaactg 88 # 19
Fatty acid binding protein 4 FABP4 cctttaaaaatactgagatttccttca ggacacccccatctaaggtt 105 # 72