Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Description of primers used in qRT-PCR
| Gene | Sequence 5’ → 3’ | NIH Genbank access no. | PCR product size (bp) |
|---|---|---|---|
| GAPDH | F: caacgaatttggctacagca | NM_001082253 | 186 |
| R: aaactgtgaagaggggcaga | |||
| ALDH | F: gagtggcatgattcagtgagc | AY503694 | 186 |
| R: gagtagtcgtcccctcttgga | |||
| Vimentin | F: tgcaggaagagattgccttt | AY465353 | 117 |
| R: tgaggtcaggcttggagaca | |||
| α-SMA | F: tcgacatcaggaaggacctct | X60732 | 206 |
| R: catctgctgaaaggtggacag |
