Table 1.
PCR primers of HCoV-OC43 and HCoV-HKU1
| Target gene | HCoV | Primer | Locationa | Sequence (5'-3') | Reference |
|---|---|---|---|---|---|
| Spike (S) | OC43 | LPW 1261 | 24010-24029 | Forward: CTRCTATARYTATAGGTAGT | [11] |
| LPW 2094 | 24866-24887 | Reverse: GCCCAAATTACCCAATTGTAGG | [11] | ||
| HKU1 | LPW 1832 | 23275-23299 | Forward: TATGTTAATAAWACTTTGTATAGTG | [40] | |
| LPW 1866 | 24197-24218 | Reverse: TACAATTGACAAGAACTAGAAG | [40] | ||
| Nucleocapsid (N) | OC43 & HKU1 | βN-F | OC43: 28974-28996 | Forward: GCTGTTTWTGTTAAGTCYAAAGT | this study |
| HKU1: 28218-28240 | |||||
| βN-R | OC43: 30479-30501 | Reverse: CATTCTGATAGAGAGTGCYTATY | this study | ||
| HKU1: 29699-29721 | |||||
| βN-Fn | OC43: 29046-29069 | Forward (nested): GCMTTGTTRAGARMTWAWATCTAA | this study | ||
| HKU1: 28287-28310 | |||||
| βN-Rn | OC43: 30447-30466 | Reverse (nested): GCGAGGGGTTACCACCWRRT | this study | ||
| HKU1: 29671-29690 | |||||
| 1a | OC43 | OC43-1aF | 6145-6167 | Forward: CTTTTGGTAAACCTGTTATATGG | this study |
| OC43-1aR | 7329-7351 | Reverse: AGCTTAATAAAAGAGGCAATAAT | this study | ||
| OC43-1aFn | 6183-6199 | Forward (semi-nested): GCTTCYCTCAATTCTTTAACAT | this study | ||
| HKU1 | HKU1-1aF | 6448-6471 | Forward: TTCTCTTACTTATTTTAATAAACC | this study | |
| HKU1-1aR | 7587-7610 | Reverse: CTTTATACATAGCAGTAACAACTA | this study |
aNucleotide location was determined based on the HCoV-OC43 ATCC VR-759 (AY585228) and HCoV-HKU1 (NC_06577) reference sequences