Skip to main content
. 2015 Dec 30;6(3):623–629. doi: 10.1534/g3.115.025320

Figure 1.

Figure 1

Confirmation of PB3500 cybrid genotypes. (A) Mitochondrial amplification products. Primers: cbr-nad-5 - AGCCAAACTCTAACACCACCT and cbr-nad-3 - TTCTTGGGGATTTTAGTTTCTGA. A 506 bp amplification product was expected from C. briggsae AF16 mitochondria. No product expected from C. nigoni EG5268 mitochondria. (B) Amplification products from the X-linked cbr-vab-3 and cni-vab-3 orthologs. Amplification products of 334 and 297 bp were expected from C. briggsae AF16 and C. nigoni EG5268, respectively. Primers: exon 4 - TGCACTCGGGCATACTGTAA and exon 6 - TGTACAACGGGCTCAGTCAG.