Table 1.

SLC44A2 alleles (confirmed haplotypes) and their frequencies in African Americans and Caucasians

Allele number	Allele (haplotype)*	GenBank No.	Allele frequency
			African American			Caucasian
			Observed (n)	Mean†	95% CI‡	Observed (n)	Mean†	95% CI‡
1	TGCGCCTGCGTTTCGCTTTACCCCGCCCCCTGGCTGGT	KM024996	219¶	54.8%	47.4-62.3	76¶	39.6%	30.6-49.1
2	------CA-ACCG---CC--T------T-------A-G	KM024997	10¶	2.5%	1.3-4.4	25¶	13%	8.7-18.8
3	---A--CA-ACCG---CC--T------ T-------A-G	KM024998	3¶	0.8%	0.2-2.0	11¶	5.7%	2.8-9.9
4	------CA--CCG---CC-----AA--T-------A-G	KM024999	16	4%	2.4-6.3	1	0.5%	0.03-2.8
5	------CA--CCG----C-----AA--T-------A-G	KM025000	4	1%	0.3-2.4	0	0%	0-1.7
6	-A----C---CCG----C---------T-T-----A--	KM025001	4	1%	0.3-2.4	0	0%	0-1.7
7	----T---------------T------T-------A-G	KM025002	6¶	1.5%	0.6-3.2	22¶	11.5%	7.2-16.8
8	--------------------T------T-------A-G	KM025003	2	0.5%	0.09-1.7	2	1%	0.18-2.9
9	--------------------T-------A-G	KM025004	6	1.5%	0.6-3.2	0	0%	0-1.7
10	------------------CG-TA---------A--A--	KM025005	16	4%	2.4-6.3	0	0%	0-1.7
11	------------------CG-TA---------A-CA--	KM025006	4	1%	0.3-2.4	0	0%	0-1.7
12	-------------------G-TA---------A--A--	KM025007	5	1.2%	0.5-2.8	0	0%	0-1.7
13	---------------------------T--C-A--A--	KM025008	6	1.5%	0.6-3.2	0	0%	0-1.7
14	----T--------------------T-T-------A--	KM025009	0¶	0%	0-0.8	7¶	3.6%	1.7-7.2
15	-------------------------T-T-------A--	KM025010	7	1.8%	0.8-3.4	2	1%	0.18-2.9
16	---------------------------T-------A--	KM025011	6	1.5%	0.6-3.2	1	0.5%	0.03-2.8
17	--T-T---------------------------------	KM025012	1	0.2%	0.01-1.3	3	1.6%	0.4-4.2
18	----T-----------------------G---------	KM025013	4	1%	0.3-2.4	7	3.6%	1.7-7.2
19	-----T-------------------------A------	KM025014	7	1.8%	0.8-3.4	1	0.5%	0.03-2.8
20	--------------------------T---------A-	KM025015	5	1.2%	0.5-2.8	0	0%	0-1.7
21	A-------------------------------------	KM025016	3	0.8%	0.2-2.0	0	0%	0-1.7
22	-A------------------------------------	KM025017	9	2.2%	1.1-4.2	0	0%	0-1.7
23	---A----------------------------------	KM025018	4	1%	0.3-2.4	1	0.5%	0.03-2.8
24	----T----- ----------------------------	KM025019	3¶	0.8%	0.2-2.0	15¶	7.8%	4.2-12.4
25	-----T--------------------------------	KM025020	1	0.2%	0.01-1.3	0	0%	0-1.7
26	--------T----------------------------	KM025021	1	0.2%	0.01-1.3	2	1%	0.18-2.9
27	------------------C------------------	KM025022	3	0.8%	0.2-2.0	0	0%	0-1.7
28	----------------------------G---------	KM025023	2	0.5%	0.09-1.7	3	1.6%	0.4-4.2
29	-----------------------------------A--	KM025024	2	0.5%	0.09-1.7	0	0%	0-1.7
30	------------------------------------A-	KM025025	5	1.2%	0.5-2.8	7	3.6%	1.7-7.2
Potential haplotypes	See Table S5		36			6
Total			400			192

^*The nucleotides at the 38 SNP positions with variations are shown in 5‘ to 3‘ orientation (see Figure 1 and Table S6). The remaining 8131 nucleotide positions that we determined had no variation relative to the reference sequence KM024996. The SNP G/A (bold) determines the HNA-3a/b antigen polymorphism.

^†Number of observed alleles (n)/Total number of alleles (African American=400 and Caucasian=192).

^‡95% confidence interval (CI), Poisson distribution, two sided.³⁷

^¶Statistically significant difference by the Fisher’s exact test, two sided (p<0.0017); Bonferroni multiple comparison correction, n=30, 0.05/30=0.0017. The same alleles show statistically significant differences when the Bonferroni-Holm correction is applied.