Table 1.
List of primers and probes used in this study. Primers AL3531 and AL3535 are used in the first round and primers AL3532 and AL3534 are nested primers used in the second round to amplify part of the GP60 gene. The primers CRULib13F and CRULib13RCp in combination with probe CRULib13TMCp amplify and detect specifically a hypothetical gene of C. parvum whereas primers ChomGP60f, ChomGP60r and probe ChomGP60Tp amplify part of the GP60 and specifically detect C. hominis
| Name | Sequence | 5’label | 3’label |
|---|---|---|---|
| ATGFOR | atgagattgtcgctcattatc | ||
| AL3533REV | agatatatcttggtgcg | ||
| AL3531 | atagtctccgctgtattc | ||
| AL3535 | ggaaggaacgatgtatct | ||
| AL3532 | tccgctgtattctcagcc | ||
| AL3534 | gcagaggaaccagcatc | ||
| CRULib13F | tccttgaaatgaatatttgtgactcg | ||
| CRULib13RCp | ttaatgtggtagttgcggttgaac | ||
| CRULib13TMCp | tatctcttcgtagcggcgta | Vic | MGB-NFQ |
| ChomGP60F | aaagaacaatgaagaaagccaaa | ||
| ChomGP60R | ggtagaaggttgggtagcactct | ||
| ChomGP60Tp | tcaaggtggctccaaaggagacg | Texas Red | BHQ2 |