|
E. coli BL21 (DE3) |
F−ompT hsdSB(rB− mB−) gal dcm (DE3) |
Novagen |
|
E. coli Rosetta (DE3) |
F−ompT hsdSB(rB− mB−) gal dcm (DE3) pRARE |
Novagen |
|
M. smegmatis mc2 155 |
A high efficiency transformation strain of M. smegmatis
|
(36) |
| pET14bMsmUdgX |
pET14b plasmid with MsmUdgX cloned in its NdeI/HindIII sites |
This study |
| pET14bMavUdgX |
pET14b plasmid with MavUdgX cloned in its NdeI/HindIII sites |
This study |
| pET14bRimUdgX |
pET14b plasmid with RimUdgX cloned in its NdeI/HindIII sites |
This study |
| pMVUdgX |
pMV261(hygR) plasmid with UdgX ORF cloned in its BamHI/HindIII site |
This study |
| pMVUdgX350 |
pMV261(hygR) plasmid with UdgX ORF with 350 upstream region taking the native promoter along with it and cloned in XbaI/PstI replacing the hsp60 promoter present in pMV261 |
This study |
| SSU9 |
Substrate for UDG assay having uracil in the 9th position 5′CTCAAGTGUAGGCATGCAAGAGCT3′ |
(30) |
| SSU9:G |
Oligomer complimentary to SSU9 with G opposite to uracil 5′CTTGCATGCCTGCACTTGAGTGCA 3′ |
(30) |
| DHU |
5′ GGCTGCTAC(DHU)AGGCGAAGTG 3′ |
(30) |
| Hx |
5′ GGCTGCTAC(Hx)AGGCGAAGTG 3′ |
(30) |
| HmU |
5′CTCAAGTG(HmU)AGGCATGCAAGAGCT3′ |
This study |
| M. smegmatis ΔrecA |
M. smegmatis mc2 155 strain where recA gene is disrupted with kanR cassette |
This study |
|
E. coli MG1655 |
An E. coli K strain, F− λ−rph-1
|
(37) |
|
E. coli (WT) (BW22113) |
F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ−, rph-1, Δ(rhaD-rhaB)568, hsdR514
|
(38) |
|
E. coli ΔrecA (BW26355) |
BW22113 but ΔrecA635::kan
|
(38) |
|
E. coli ΔuvrB (JW0762–2) |
BW22113 but ΔuvrB751::kan
|
(38) |
|
E. coli ΔrecB (JW2788–1) |
BW22113 but ΔrecB745::kan
|
(38) |
|
E. coli ΔruvA (JW1850–2) |
BW22113 but ΔruvA786::kan
|
(38) |
|
E. coli ΔdinB (JW0221–1) |
BW22113 but ΔdinB749::kan
|
(38) |
|
E. coli ΔumuDC (EJ120) |
AB 1157 but Δ (umuDC)595::Chl |
(53) |
| pTrcUgi |
pTrc99a plasmid with Ugi ORF (EcoRV/BamHI end filled) cloned in EcoRI (end filled) site |
This study |
| pTrcUdgX |
pTrc99c plasmid with MsmUdgX ORF cloned in NcoI/HindIII site |
This study |
| pTrcUdgX-Ugi |
pTrcUdgX with Ugi (released from pTrcUgi EcoRV/HindIII endfilled) cloned in EcoRV site |
This study |
| pMVUgi |
pMV261 (KanR) with Ugi ORF (EcoRV/BamHI end filled) cloned in EcoRI(end filled) site |
This study |
| pMVUdgX |
pMV261 (HygR)with MsmUdgX ORF cloned in BamHI/HindIII site |
This study |
| pMVUdgX-Ugi |
pMVUdgX with Ugi (released from pMVUgi digested with XbaI/NheI) cloned in XbaI site |
This study |
