Abstract
Different strains and species of the soil phytopathogen Agrobacterium possess the ability to transfer and integrate a segment of DNA (T-DNA) into the genome of their eukaryotic hosts, which is mainly mediated by a set of virulence (vir) genes located on the bacterial Ti-plasmid that also contains the T-DNA. To date, Agrobacterium is considered to be unique in its capacity to mediate genetic transformation of eukaryotes. However, close homologs of the vir genes are encoded by the p42a plasmid of Rhizobium etli; this microorganism is related to Agrobacterium, but known only as a symbiotic bacterium that forms nitrogen-fixing nodules in several species of beans. Here, we show that R. etli can mediate functional DNA transfer and stable genetic transformation of plant cells, when provided with a plasmid containing a T-DNA segment. Thus, R. etli represents another bacterial species, besides Agrobacterium, that encodes a protein machinery for DNA transfer to eukaryotic cells and their subsequent genetic modification.
Author Summary
Since the discovery of gene transfer from Agrobacterium to host plants in the late 1970s, this bacterial pathogen has been widely used in research and biotechnology to generate transgenic plants. Agrobacterium’s infection process relies on a set of virulence proteins that mediate the transfer of a segment of its own DNA (T-DNA) into the host cell genome. To date, Agrobacterium is believed to be the only prokaryote with the capability of cross-kingdoms gene transfer. However, homologs of the Agrobacterium’s virulence proteins are found in some symbiotic plant-associated bacterial species, belonging to the Rhizobium genus. Here we show that one of these species, Rhizobium etli, encodes a complete set of virulence proteins and is able to mediate transfer and integration of DNA into host-plant cell genome, when provided with a T-DNA. This is the first time that a bacterium-to-plant DNA transfer machinery encoded by a non-Agrobacterium species is shown to be functional.
Introduction
The Rhizobiales order contains many species of plant-associated bacteria, such as the related genera Agrobacterium and Rhizobium. Phylogenetic analyses based on 16S rDNA sequences led to the idea that Agrobacterium and Rhizobium could be regrouped into one genus [1]. Yet their lifestyles are very different. Agrobacterium comprises species that are often, but not always [2, 3], pathogenic and can genetically transform their host plant cells by transferring a segment of their own plasmid, the T-DNA, and induce neoplastic growths that synthesize small molecules used as nutrients by the bacteria [4–6]. This Agrobacterium capability to modify genetically their host cells is widely used in research and biotechnology for generating transgenic plants [7] as well as fungi [8]. In contrast, Rhizobium belongs to a group of very diverse symbiotic bacteria (collectively termed rhizobia) that form nitrogen-fixing nodules on the roots of legume plants [9–12]. Rhizobium and Agrobacterium species have complex genomes composed of one or two chromosomes and several plasmids [13–16]; the chromosomes are designed as “core” components defining the species as opposed to the “accessory” components that are the plasmids [17]. The outcome of interactions of these bacteria with plants is essentially determined by large specialized plasmids, the tumor inducing (Ti) plasmid for Agrobacterium, and symbiotic (pSym) plasmid for Rhizobium. Indeed, introducing an Agrobacterium Ti plasmid into some rhizobia species resulted in virulent bacteria capable of inducing tumors in host plants [18]. In general, rhizobia species are known to gain T-DNA transfer ability only when provided with the virulence (vir) genes [4, 5] of the Agrobacterium Ti plasmid [19, 20]. Rhizobium, therefore, is thought to possess chromosomal, but not plasmid-based factors required for plant genetic transformation, and because of that lack endogenous DNA transfer capacity.
Intriguingly, however, many Rhizobium species harbor different sets of homologs of the Agrobacterium vir genes; specifically, R. etli carries a complete set of vir genes [15, 21] whereas the closely related R. leguminosarum lacks such degree of homology. Here, we show that R. etli can independently mediate functional DNA transfer and stable genetic transformation of plant cells, when provided with a plasmid containing a T-DNA segment. Thus, R. etli represents another bacterial species, in addition to Agrobacterium, capable of genetic modification of plants.
Results
vir gene homologs in R. etli
Sequencing of the R. etli CFN42 genome revealed that it encodes a complete set of virulence (Vir) proteins encoded by the vir genes [15, 22]. Indeed, Fig 1A shows that all the essential Vir proteins encoded by the p42a plasmid of R. etli exhibit a high level of homology with their counterparts from different Agrobacterium Ti plasmids, except for the VirD3 and VirD5 proteins, which are non-essential for DNA transfer. Phylogenetic analysis demonstrated that the Vir proteins of R. etli and Agrobacterium are very close to each other, as exemplified for VirE2 (Fig 1B). In contrast, the putative Vir protein orthologs of R. leguminosarum only share a relatively weak homology, i.e., usually less than 40% identity, with Agrobacterium. Fig 1C shows that, within the p42a plasmid of R. etli, the vir genes are grouped in a cluster, forming a virulence region that is similar in many ways with the vir region of Agrobacterium Ti-plasmids, but it also displays some notable differences. Specifically, the organization of the “core” of the vir region—the virA, virB, virG, virC, virD, and virE operons—is nearly identical, but the order of the virD and virE operons is inverted in R. etli. In addition, in R. etli, the virB2 coding sequence is not part of the virB operon, but is located at a distant locus on the same plasmid, and two virF homologs are present, virF1 and virF2, which are related to the virF genes from octopine (A6) and nopaline (C58) Agrobacterium strains, respectively. The presence of many transposase insertion sequences in the vicinity of the vir cluster of R. etli [15] may explain the rearrangements in the organization of the vir region. In R. leguminosarum, the organization of the vir region located on the pRL7 plasmid appears to be scrambled, with several operons having been duplicated (see the pRL7 map in the KEGG database, http://www.genome.jp/kegg/). Although other Rhizobium species, such as R. mesoamericanum and R. tropici, contain homologs of several vir genes (S1 Table), a high level of homology with all essential vir genes is found only in R. etli. Whereas a complete vir region is present in the R. etli p42a plasmid which is homologous to the Agrobacterium vir genes, we could not detect homologies to any of the Agrobacterium T-DNA sequences; specifically, our search for T-DNA-specific oncogenes and opine synthesis genes and for the T-DNA border sequences did not yield significant homology.
Fig 1. Sequence comparison of Agrobacterium and Rhizobium Vir proteins and organization of the vir gene regions.
A, percentage of sequence identity between orthologs of Vir proteins in A. tumefaciens A6, A. vitis S4, A. rhizogenes, R. etli CFN42, and R. leguminosarum bv. viciae 3841, with A. tumefaciens C58 as reference; color codes correspond to percentage of identity as indicated, grey background under the protein name indicates the proteins essential for T-DNA transfer by Agrobacterium. B, phylogenetic tree of VirE2 protein orthologs from the bacterial species listed in A, except for A. rhizogenes that does not encode VirE2. The evolutionary history was inferred using the Neighbor-Joining method [44]. The optimal tree with the sum of branch length = 2.23186255 is shown. The percentage of replicate trees, in which the associated taxa clustered together in the bootstrap test (1,000 replicates) is shown next to the branches [45]. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method [46] and are in the units of the number of amino acid substitutions per site. The analysis involved 5 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 509 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 [29]. Bar = 0.2 amino acid substitution per site. C, organization of vir gene regions of A. tumefaciens C58, A. tumefaciens A6 and R. etli CFN42.
Transient and stable genetic transformation of plants by R. etli
To examine potential functionality of the vir genes of R. etli, we introduced into R. etli cells a plasmid that harbors a T-DNA sequence with reporter genes gfp or gus-int, and selection gene nptII but lacks any vir sequences. This strain was then tested for its ability to promote transient T-DNA expression in plant cells and generate stably transformed transgenic plants, and compared to A. tumefaciens EHA105, one of the standard strains for plant genetic transformation [24]. After infiltration of Nicotiana benthamiana leaves with R. etli, expression of both GFP (Fig 2A and 2B) and β–glucuronidase (GUS) reporters (Fig 2C) was consistently observed in the inoculated plant tissues, although expression levels with R. etli were about ten times lower than those with A. tumefaciens (Fig 2B). Thus, R. etli was able to transfer to plant cells DNA that subsequently could be expressed. In contrast, in similar experiments performed with R. leguminosarum, transient expression of the reporter gfp or gus-int genes was never observed (Fig 2).
Fig 2. Transient expression of reporter genes delivered to plants by R. etli.
A, expression of GFP in N. benthamiana leaf tissue 3 days after infiltration with A. tumefaciens EHA105, R. etli CE3 and R. leguminosarum 3841, harboring the pCB302T-GFP plasmid. Plastid autofluorescence is in red, GFP fluorescence is in green. Bar = 50 μm. B, numbers of GFP-expressing cells per cm2 of infiltrated leaf surface. C, GUS activity in leaf discs from infiltrated N. benthamiana leaves 3 days after infiltration with the indicated dilutions of cultures of A. tumefaciens EHA105, R. etli CE3 or R. leguminosarum 3841, harboring the pBISN1 plasmid.
That R. leguminosarum—which is very closely related to R. etli, except for the vir region—is unable to effect genetic transformation suggests that it is the vir genes that are required for the T-DNA transfer by R. etli. We tested this notion directly using R. etli carrying p42a with virG or virE2 genes mutated by insertion of a promoterless gusA gene [21]. PCR-based analysis using primers specific for gusA and virG and virE2 showed that R. etli cells with the mutated p42a plasmids, i.e., p42a virGmut and p42a virE2mut, indeed, contained the mutagenic sequences inserted in the sense orientation within the virG and virE2 genes. Specifically, Fig 3A shows that the reverse primer, corresponding to the 3’-end of gusA, and forward primers, corresponding to the 5’-ends of virG and virE2, amplified fragments of ca. 2.3 Kb (lane 1) and 2.8 Kb (lane 5) for the virGmut and virE2mut mutants, respectively, but not for the wild-type genes in the same strains, i.e., for virE2 in the virGmut strain (lane 2) and for virG in the virE2mut strain (lane 4). As expected, no gusA sequences were detected in the wild-type p42a plasmid (Fig 3A, lanes 7, 8) whereas all samples contained bacterial chromosomal DNA (Fig 3A, lanes 3, 6. 9). Neither of these plasmids was able to promote transfer and transient expression of the gfp reporter gene (Fig 3B). In control experiments with R. etli carrying the wild-type p42a, the gfp reporter was transferred to plant cells, resulting in expression of its protein product (Fig 3B, see also Fig 2A). These observations suggest that the T-DNA transfer mediated by R. etli relies on and requires its vir genes.
Fig 3. DNA delivery to plants by R. etli depends on vir genes of p42a.
A, PCR analysis of the presence of mutagenic gusA in the virG and virE2 genes of the mutant p42a plasmids. Lanes 1–3, R. etli carrying p42a with mutant virG (virGmut). Lanes 4–6, R. etli carrying p42a with mutant virE2 (virE2mut). Lanes 7–9, R. etli carrying wild-type p42a. DNA samples were amplified with primers specific for gusA and virG (lanes 1, 4, 7), gusA and virE2 (lane 2, 5, 8), or chromosomal DNA (lanes 3, 6, 9). Lane M, molecular size markers. Numbers on left indicate molecular sizes in thousands of base pairs (Kb). B, Transient expression of GFP in N. benthamiana leaf tissue 3 days after infiltration with R. etli carrying p42a virGmut, p42a virE2mut, or wild-type p42a. Plastid autofluorescence is in red, GFP fluorescence is in green. Bar = 50 μm.
For stable genetic transformation, tobacco (N. tabacum) leaf discs were inoculated with R. etli or A. tumefaciens harboring a plasmid with the selection gene nptII encoding resistance to kanamycin as well as the gfp marker gene in its T-DNA. Regenerating plantlets were observed after four weeks incubation under kanamycin selection, which indicates stable genetic transformation (Fig 4A and 4B). Consistent with the transient T-DNA expression data, the genetic transformation efficiency mediated by R. etli was much lower than with A. tumefaciens (compare Fig 4A to Fig 4B). Confirming stable transgene expression in the regenerated plants, GFP was observed in a typical nucleocytoplasmic pattern in virtually all cells in leaves of one-month-old transgenic plants generated using R. etli (Fig 4C).
Fig 4. Generation of transgenic plants using R. etli.
A, B, regeneration of transgenic tobacco plantlets on kanamycin selection medium, 4 weeks after inoculation with A. tumefaciens EHA105 (A) or R. etli CE3 (B), harboring pBin19-EGFP. Arrow indicates a regenerated plantlet. C, expression of GFP in leaf of transgenic plantlets generated using R. etli CE3, harboring pBin19-EGFP. Image is a projection of several confocal sections. Plastid autofluorescence is in red, GFP fluorescence is in green. Bar = 10 μm.
Finally, we confirmed the actual presence of the T-DNA within the genome of these transformed plants. Genomic DNA was isolated from two independent stable transgenic lines, designated TL1 and TL2, and from a wild-type, untransformed plant and analyzed by Southern blot hybridization. Specifically, the DNA samples were digested with EcoRI and hybridized them with a probe corresponding to the T-DNA right border-proximal nos promoter region of the T-DNA of pBin19-RCS1-GFP that has no recognition sites for EcoRI. Fig 5A shows that no hybridization signal was detected in the DNA from the wild-type plant (lane 1) whereas T-DNA-specific signal was present in the DNA of both transgenic TL1 and TL2 lines (lanes 2, 3, asterisks), suggesting a single integration site of the T-DNA within the genome of each of the tested plants. When we similarly digested purified pBin19-RCS1-GFP DNA, which has only one EcoRI recognition site in its entire sequence, a 11.9-kb band, corresponding to the linearized plasmid, was observed (Fig 5B, lane 1). Additional negative controls, which probed EcoRI-digested wild-type and transgenic plant DNA with sequences specific for the p42a plasmid (Fig 5B, lanes 2, 3) or for the R. etli chromosome (Fig 5B, lanes 5, 6) did not yield any signal. As expected, positive controls detected specific signals using undigested p42a DNA hybridized to the p42a-specific probe (Fig 5B, lane 4) and undigested R. etli chromosomal DNA hybridized with the chromosome-specific probe (Fig 5B, lane 7).
Fig 5. Southern blot analysis of two independent kanamycin-resistant and GFP-expressing transgenic tobacco lines.
(A) Detection of the transgene. Total DNA from transgenic lines TL1 and TL2 was digested with EcoR1 and probed with the nos promoter region of the T-DNA segment of pBin19-RCS1-GFP. Left four lanes, Ethidium-bromide stained agarose gel prior to transfer. Right three lanes, Southern blot of the lanes shown on left. Lane M, molecular size markers (from top to bottom: 12, 11, 10, 9, 8, 7, 6, 5, 4, 3 kb); lane 1, wild-type, untransformed plant; lane 2, plant TL1; lane 3, plant TL2. Asterisks indicate the hybridized bands of the integrated T-DNA. (B) Control hybridizations. Lane 1, free pBin19-RCS1-GFP plasmid. Lanes 2, 5, wild-type, untransformed plantlet. Lanes 3, 6, transgenic line TL1. Lane 4, undigested p42a plasmid of R. etli. Lane 7, undigested chromosomal DNA of R. etli. DNA samples were digested with EcoRI (lanes 1–3, 5, 6). The blots were probed with the nos promoter region of the T-DNA segment of pBin19-RCS1-GFP (lane 1), the virB5 gene from p42a plasmid of R. etli (lanes 2–4) or a 320-bp segment of R. etli chromosomal DNA (lanes 5–7). Asterisks indicate the hybridized bands of free pBin19-RCS1-GFP (lane 1), free undigested p42a (lane 4), or total R. etli chromosomal DNA (lane 7).
Taken together, the stable expression of two marker genes, gfp and nptII, and the physical presence of the transforming DNA in the plant genomic DNA, indicate that the T-DNA was indeed integrated into the plant genome.
Discussion
Our results demonstrate that R. etli within its p42a plasmid contains a complete and functional vir region, encoding a set of Vir proteins able to mediate functional T-DNA transfer into plant cells. Whereas it has been known that the vir genes from Agrobacterium can function in several rhizobia species [18, 19], this is the first time that an endogenous virulence system encoded by a non-Agrobacterium species is shown to be functional in DNA transfer and stable genetic transformation.
The virE2 and virG mutants, which render R. etli unable to promote genetic transformation, previously have been shown to have no effect on formation of nitrogen-fixing nodules or on nodulation competitiveness [21]. Thus, the vir genes likely fulfill a function unrelated to symbiosis. Two factors might account for the presence of a functional vir region in R. etli. First, the ability to transform host plant cells may have been widespread among bacterial species in the past, and not restricted to the Agrobacterium genus. That we could not identify T-DNA-like sequences in R. etli suggests that Rhizobium-mediated plant transformation does not occur at present, although it cannot be ruled out that other Rhizobium strains, not yet sequenced, harbor a T-DNA. Furthermore, proteins from other rhizobia, such as Mesorhizobium loti R7A (see S1 Table for Vir protein sequence homologies with M. loti R7A), can be recognized by the Agrobacterium VirB/D4 type IV secretion system (T4SS) and exported to plant cells [25], suggesting that T4SS could substitute for the type III secretion system (T3SS) during effector protein translocation in some rhizobia species. Thus, the VirB/D4 T4SS encoded by p42a could also function to translocate protein effectors in R. etli. Second, because the p42a plasmid is transmissible between Rhizobium and Agrobacterium [21], this plasmid may belong to an “interspecies plasmid pool”, and R. etli may function as a “vector” for p42a which is then transferred to Agrobacterium and only then used for plant genetic transformation. It would be interesting to examine whether quorum sensing signals that activate conjugative transfer of plasmids between Agrobacterium cells also induce conjugation between Rhizobium and Agrobacterium. Indeed, in natural Agrobacterium populations, Ti-plasmids are not present in all cells [2, 3], but, in response to bacterial and plant signals via a quorum sensing mechanism, conjugative plasmid transfer can be activated [26].
The need to identify or even generate non-Agrobacterium bacterial species that could be used as a vector for plant genetic transformation has been emphatically articulated [27]. First, a non-Agrobacterium vector might be more efficient in some hosts that are difficult to transform by Agrobacterium. Indeed, although the efficiency of R. etli mediated transformation of Nicotiana species was very low compared to Agrobacterium, R. etli might be more efficient with other plant species, such as its native hosts. Second, several aspects of plant genetic transformation methods are legally limited by existing patents, and using a different bacterial species may help to circumvent these limitation and avoid litigation [28].
In conclusion, we demonstrate that R. etli, a symbiotic Rhizobium species different from the phytopathogenic Agrobacterium, contains the complete molecular machinery able to transfer DNA to the plant genome, which has implications for evolution and origin of the Agrobacterium virulence system as well as for potential utilization in biotechnology.
Materials and Methods
Protein sequence analysis
Protein sequences were compared using the blastp program (PubMed); the percentages of identity of full sequences were calculated as the percentage of identity corrected by the query cover percentage. VirE2 phylogenetic tree was generated using MEGA version 6 [29], via the minimum evolution method. The KEGG database release 71.0 (http://www.genome.jp/kegg/) was used to design schematic maps for the different vir regions.
Bacterial strains
R. etli CE3, a streptomycin-resistant isolate of the CFN42 strain, and R. leguminosarum bv. viciae strain 3841 (kindly provided by Dr. Russell Carlson, University of Georgia, Athens) were grown in TY medium (5 g.L-1 tryptone, 3 g.L-1 yeast extract, and 10 mM CaCl2). A. tumefaciens strain EHA105, derived from nopaline wild-type strain C58.C1, was grown as described [30]. T-DNA containing plasmids were introduced into these Agrobacterium and Rhizobium strains using the classical CaCl2 protocol, with minor modifications in the case of Rhizobium [31]. R. etli strains, carrying p42a with mutated virG and virE2 genes were described previously [21].
Plasmids
For transient expression of GFP, pCB302T-GFP was obtained by inserting the gfp expression cassette from pSAT1-EGFP-C1 [32] into the AgeI-BglII sites of pCB302T-MCS [33], derived from pCB302 [34]. For transient expression of GUS, pBISN1 [35], carrying an expression cassette for a gus reporter gene with a plant intron sequence (gus-int), was used. For stable transformation, the multiple cloning site of pPZP-RCS1 [36] was first introduced into the EcoRI-HindIII sites of pBin19 [37], forming pBin19-RCS1. Then, the gfp expression cassette from pSAT1-EGFP-C1 was inserted into the AscI site of pBin19-RCS1, resulting in pBin19-RCS1-GFP carrying both nptII and gfp expression cassettes in its T-DNA segment.
Transient and stable plant transformation
Agrobacterium and Rhizobium strains carrying pCB302T-GFP or pBISN1 were grown 24–48 h at 28°C, and infiltrated into intact N. benthamiana leaves as described [38]. The bacterial suspension was first adjusted to OD600nm 0.6 and then diluted 20 or 50 times before infiltration. Reporter gene expression was monitored three days after infiltration. For detection of GUS expression, leaf discs were excised from the infiltrated zone and subjected to the histochemical assay as described [39]. GFP expression was observed under a Zeiss LSM 5 Pascal confocal microscope at low magnification with a 10x objective; the number of GFP-expressing cells per cm2 of infiltrated leaf surface was counted as described [38].
Stable genetic transformation was performed using N. tabacum cv. Turk and Agrobacterium and Rhizobium strains carrying pBin19-RCS1-GFP in the classical leaf disc protocol [40]. Transgenic plantlets were selected on MS regeneration medium (30 g.L-1 sucrose, 8 g.L-1 agar, 10 mg.L-1 BAP, 1 mg.L-1 NAA) supplemented with 50 mg.L-1 timentin and 50 mg.L-1 kanamycin. Images of regenerated transgenic plantlets were recorded after 4 weeks of incubation on the regeneration/selection medium, using a Leica MZ FLIII stereoscope. Regenerated plantlets were then placed on rooting medium (30 g.L-1 sucrose, 8 g.L-1 agar) supplemented with 25 mg.L-1 kanamycin for one month before GFP expression in the leaves was analyzed by confocal microscopy as described above, but with a 40x objective.
PCR analysis of mutated p42a plasmids
Total DNA was extracted from cultures of R. etli harboring p42a, p42a virGmut, or p42a virE2mut [21] and PCR-amplified for 32 cycles using the primer pairs 5’ATGAAAGGTGAACGGTTGAAACAC3’/5’CCGGAATTCTCATTGTTTGCCTCCCTGCTGC3’ specific for virG (RHE_PA00053) and gusA, 5’ATGGATCCGAAAAGCGAAGACAAT3’/5’CCGGAATTCTCATTGTTTGCCTCCCTGCTGC3’ specific for virE2 (RHE_PA00061) and gusA, or 5’CTCCTGCGTGTCCTGATTGGC3’/5’AGCGGCGCGACGAACGTGAC3’ specific for a 320-bp segment of the R. etli chromosome between positions 109,451 and 109,770. Before proceeding with this analysis, we determined the orientation of the mutagenic gusA insertion in the virG and virE2 genes. We showed that, with forward primers corresponding to the 5’-ends of virG and virE2, a PCR product was observed only with the reverse primer corresponding to the 3’-end of gusA, but not with the primer corresponding to its 5’-end (S1 Fig), which reflects the sense orientation of gusA both within virG and virE2.
Southern blot analysis
Total genomic DNA of wild type and transgenic tobacco plants was purified using the DNeasy plant DNA extraction kit (Qiagen) according to the manufacturer’s instructions. The purified DNA (10 μg) was digested with EcoR1 (New England Biolab) overnight. The digested DNA was resolved on a 1.0% agarose gel for 6 hours at 60 V, and DNA was transferred onto a nylon charged membrane with alkali transfer buffer [41]. For the T-DNA-specific probe, we used a 300-bp segment of the nopaline synthase (nos) promoter of the T-DNA region of pBin19-RCS1-GFP amplified using the primer pair 5’CAATATATCCTGTCAAACACTGATAG3’/5’GAAATATTTGCTAGCTGATAGTGAC3’; this probe fragment did not contain recognition sites for EcoRI. For the p42a-specific probe, we used a 240-bp segment of the virB5 gene amplified using the primer pair 5’5’ATGCATGAGCTCATGAAGATGTCGAGACTAGTTAC3’/5’AAAGGATCCCCTCGTGGCGGGATACTGG3’. For the R. etli genomic probe, we used a 320-bp segment of the chromosome between positions 109,451 and 109,770 amplified using the primer pair 5’CTCCTGCGTGTCCTGATTGGC3’/5’AGCGGCGCGACGAACGTGAC3’. For Southern blot analysis of transgenic plants (Fig 5A), agarose gel electrophoresis, blotting, and detection were performed at Lofstrand Labs Ltd. (Gaithersburg, MD) using a 32P labeled the T-DNA-specific probe (3.26 x 106 dpm/ml of hybridization buffer in a total volume of 50 ml). The hybridization was carried out for 3 days at 68°C; after washes, the membrane was autoradiographed for 17 hours with an intensifier screen at -80°C. For control experiments (Fig 5B), biotinylated probes were prepared using the biotin decalabel DNA labeling kit (Thermo Scientific); hybridization and detection were performed using the Phototope Star kit (NEB) according to the manufacturer’s instructions. Based on the 4.5 Gb size of the complex allotetraploid genome of N. tabacum [42], ca. 4 kb size of the T-DNA region of pBin19-RCS1-GFP, the DNA size-to-mass conversion ratio of 978 Mb = 1 pg (http://ebook2.worldlibrary.net/articles/C-value), and at least one T-DNA insertion per genome, we estimated that 10 μg of total transgenic plant DNA would contain ca. 9 pg of T-DNA, which is well within the detection range of the classical Southern blot analysis [43]. For comparable controls, we utilized 100 pg of purified pBin19-RCS1-GFP, 50 pg of p42a DNA, and 1 ng of R. etli chromosomal DNA.
Supporting Information
Lanes 1, 2, R. etli carrying p42a with mutant virG (virGmut). Lanes 3, 4, R. etli carrying p42a with mutant virE2 (virE2mut). DNA samples were amplified with forward primers specific for the 5’-end of virG (lanes 1, 2) or virE2 (lanes 3, 4) and reverse primers specific either for the 5’-end of gusA (lanes 1, 3) or the 3’-end of gusA (lane 2, 4). Lane M, molecular size markers.
(PPTX)
Gray shading indicates proteins essential for Agrobacterium tumorigenicity [23]. OLN, ordered locus name represents the naming system for sequential assignment of an identifier to each predicted gene of a completely sequenced genome (http://www.uniprot.org/help/gene_name). Percentage of identity (Identity %) and percentage of query cover (Query Cover %) are indicated. Protein sequences were compared using the blastp program (PubMed) with the corresponding protein sequences of Agrobacterium tumefaciens strain C58 as reference. NS = no proteins with significant homology were identified.
(DOCX)
Acknowledgments
We thank Dr. Russell Carlson (University of Georgia) for the gift of the Rhizobium strains, and Dr. Jo Handelsman (Yale University) for the gift of R. etli strains, carrying p42a with mutated virG and virE2 genes.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was supported by: National Institute of Health, National Institute of General Medical Science, 5R01GM05022418, http://www.nih.gov/, to VC; National Science Foundation, MCB1118491, http://www.nsf.gov/, to VC; United State Department of Agriculture, National Institute of Food and Agriculture, 20146701321556,http://www.usda.gov/wps/portal/usda/usdahome, to VC; US-Israel Binational Agriculture Research and Development Fund, IS460513C, http://www.bard-isus.com/, to VC; US-Israel Binational Science Foundation, 2011070, http://www.bsf.org.il/BSFPublic/Default.aspx, to VC. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Young JM, Kuykendall LD, Martínez-Romero E, Kerr A, Sawada H. A revision of Rhizobium Frank 1889, with an emended description of the genus, and the inclusion of all species of Agrobacterium Conn 1942 and Allorhizobium undicola de Lajudie et al. 1998 as new combinations: Rhizobium radiobacter, R. rhizogenes, R. rubi, R. undicola and R. vitis . Int J Syst Evol Microbiol. 2001;51:89–103. . [DOI] [PubMed] [Google Scholar]
- 2. Bouzar H, Moore LW. Isolation of different Agrobacterium biovars from a natural oak savanna and tallgrass prairie. Appl Environ Microbiol. 1987;53:717–21. . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Moore LW, Chilton WS, Canfield ML. Diversity of opines and opine-catabolizing bacteria isolated from naturally occurring crown gall tumors. Appl Environ Microbiol. 1997;63:201–7. . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Lacroix B, Citovsky V. The roles of bacterial and host plant factors in Agrobacterium-mediated genetic transformation. Int J Dev Biol. 2013;57:467–81. 10.1387/ijdb.130199bl [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Gelvin SB. Agrobacterium-mediated plant transformation: the biology behind the "gene-jockeying" tool. Microbiol Mol Biol Rev. 2003;67:16–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Escobar MA, Dandekar AM. Agrobacterium tumefaciens as an agent of disease. Trends Plant Sci. 2003;8:380–6. [DOI] [PubMed] [Google Scholar]
- 7. Banta L, Montenegro M. Agrobacterium and plant biotechnology In: Tzfira T, Citovsky V, editors. Agrobacterium: From Biology to Biotechnology. New York: Springer; 2008. p. 72–147. [Google Scholar]
- 8. Frandsen RJ. A guide to binary vectors and strategies for targeted genome modification in fungi using Agrobacterium tumefaciens-mediated transformation. J Microbiol Methods. 2011;87:247–62. 10.1016/j.mimet.2011.09.004 [DOI] [PubMed] [Google Scholar]
- 9. Masson-Boivin C, Giraud E, Perret X, Batut J. Establishing nitrogen-fixing symbiosis with legumes: how many rhizobium recipes? Trends Microbiol. 2009;17:458–66. 10.1016/j.tim.2009.07.004 [DOI] [PubMed] [Google Scholar]
- 10. Oldroyd GE, Murray JD, Poole PS, Downie JA. The rules of engagement in the legume-rhizobial symbiosis. Annu Rev Genet. 2011;45:119–44. 10.1146/annurev-genet-110410-132549 [DOI] [PubMed] [Google Scholar]
- 11. Gage DJ. Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol Mol Biol Rev. 2004;68:280–300. . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Mousavi SA, Österman J, Wahlberg N, Nesme X, Lavire C, Vial L, et al. Phylogeny of the Rhizobium-Allorhizobium-Agrobacterium clade supports the delineation of Neorhizobium gen. nov. Syst Appl Microbiol. 2014;37:208–15. 10.1016/j.syapm.2013.12.007 [DOI] [PubMed] [Google Scholar]
- 13. Wood DW, Setubal JC, Kaul R, Monks DE, Kitajima JP, Okura VK, et al. The genome of the natural genetic engineer Agrobacterium tumefaciens C58. Science. 2001;294:2317–23. [DOI] [PubMed] [Google Scholar]
- 14. Goodner B, Hinkle G, Gattung S, Miller N, Blanchard M, Qurollo B, et al. Genome sequence of the plant pathogen and biotechnology agent Agrobacterium tumefaciens C58. Science. 2001;294:2323–8. [DOI] [PubMed] [Google Scholar]
- 15. González V, Santamaría RI, Bustos P, Hernández-González I, Medrano-Soto A, Moreno-Hagelsieb G, et al. The partitioned Rhizobium etli genome: genetic and metabolic redundancy in seven interacting replicons. Proc Natl Acad Sci USA. 2006;103:3834–9. . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Young JP, Crossman LC, Johnston AW, Thomson NR, Ghazoui ZF, Hull KH, et al. The genome of Rhizobium leguminosarum has recognizable core and accessory components. Genome Biol. 2006;7:R34 . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Crossman LC, Castillo-Ramírez S, McAnnula C, Lozano L, Vernikos GS, Acosta JL, et al. A common genomic framework for a diverse assembly of plasmids in the symbiotic nitrogen fixing bacteria. PLOS ONE. 2008;3:e2567 10.1371/journal.pone.0002567 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Hooykaas PJJ, Klapwijk PM, Nuti MP, Schilperoort RA, Rorsch A. Transfer of the Agrobacterium tumefaciens Ti plasmid to avirulent Agrobacteria and to Rhizobium ex planta . J Gen Microbiol. 1977;98:477–84. [Google Scholar]
- 19. Broothaerts W, Mitchell HJ, Weir B, Kaines S, Smith LM, Yang W, et al. Gene transfer to plants by diverse species of bacteria. Nature. 2005;433:629–33. . [DOI] [PubMed] [Google Scholar]
- 20. Wendt T, Doohan F, Winckelmann D, Mullins E. Gene transfer into Solanum tuberosum via Rhizobium spp. Transgenic Res. 2011;20:377–86. 10.1007/s11248-010-9423-4 [DOI] [PubMed] [Google Scholar]
- 21. Bittinger MA, Gross JA, Widom J, Clardy J, Handelsman J. Rhizobium etli CE3 carries vir gene homologs on a self-transmissible plasmid. Mol Plant-Microbe Interact. 2000;13:1019–21. . [DOI] [PubMed] [Google Scholar]
- 22. Lozano L, Hernández-González I, Bustos P, Santamaría RI, Souza V, Young JP, et al. Evolutionary dynamics of insertion sequences in relation to the evolutionary histories of the chromosome and symbiotic plasmid genes of Rhizobium etli populations. Appl Environ Microbiol. 2010;76:6504–13. 10.1128/AEM.01001-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Stachel SE, Nester EW. The genetic and transcriptional organization of the vir region of the A6 Ti plasmid of Agrobacterium . EMBO J. 1986;5:1445–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Hood EE, Gelvin SB, Melchers S, Hoekema A. New Agrobacterium helper plasmids for gene transfer to plants (EHA105). Transgenic Res. 1993;2:208–18. [Google Scholar]
- 25. Hubber A, Vergunst AC, Sullivan JT, Hooykaas PJJ, Ronson CW. Symbiotic phenotypes and translocated effector proteins of the Mesorhizobium loti strain R7A VirB/D4 type IV secretion system. Mol Microbiol. 2004;54:561–74. [DOI] [PubMed] [Google Scholar]
- 26. Lang J, Faure D. Functions and regulation of quorum-sensing in Agrobacterium tumefaciens . Front Plant Sci. 2014;5:14 10.3389/fpls.2014.00014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Chilton MD. Adding diversity to plant transformation. Nat Biotechnol. 2005;23:309–10. . [DOI] [PubMed] [Google Scholar]
- 28. Nottenburg C, Rodriguez CR. Agrobacterium-mediated gene transfer: a lawyer's perspective In: Tzfira T, Citovsky V, editors. Agrobacterium: From Biology to Biotechnology. New York: Springer; 2008. p. 699–735. [Google Scholar]
- 29. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30:2725–9. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Wise AA, Liu Z, Binns AN. Culture and maintenance of Agrobacterium strains. Methods Mol Biol. 2006;343:3–14. . [DOI] [PubMed] [Google Scholar]
- 31. Vincze E, Bowra S. Transformation of rhizobia with broad-host-range plasmids by using a freeze-thaw method. Appl Environ Microbiol. 2006;72:2290–3. . [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Tzfira T, Tian GW, Lacroix B, Vyas S, Li J, Leitner-Dagan Y, et al. pSAT vectors: a modular series of plasmids for fluorescent protein tagging and expression of multiple genes in plants. Plant Mol Biol. 2005;57:503–16. [DOI] [PubMed] [Google Scholar]
- 33. Lacroix B, Citovsky V. Characterization of VIP1 activity as a transcriptional regulator in vitro and in planta . Sci Rep. 2013;3:2440 10.1038/srep02440 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Xiang C, Han P, Lutziger I, Wang K, Oliver DJ. A mini binary vector series for plant transformation. Plant Mol Biol. 1999;40:711–7. . [DOI] [PubMed] [Google Scholar]
- 35. Narasimhulu SB, Deng XB, Sarria R, Gelvin SB. Early transcription of Agrobacterium T-DNA genes in tobacco and maize. Plant Cell. 1996;8:873–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Goderis IJ, De Bolle MF, Francois IE, Wouters PF, Broekaert WF, Cammue BP. A set of modular plant transformation vectors allowing flexible insertion of up to six expression units. Plant Mol Biol. 2002;50:17–27. [DOI] [PubMed] [Google Scholar]
- 37. Bevan MW. Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res. 1984;12:1811–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Lacroix B, Citovsky V. Extracellular VirB5 enhances T-DNA transfer from Agrobacterium to the host plant. PLOS ONE. 2011;6:e25578 10.1371/journal.pone.0025578 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Nam J, Mysore KS, Zheng C, Knue MK, Matthysse AG, Gelvin SB. Identification of T-DNA tagged Arabidopsis mutants that are resistant to transformation by Agrobacterium . Mol Gen Genet. 1999;261:429–38. [DOI] [PubMed] [Google Scholar]
- 40. Horsch RB, Fraley RT, Rogers SG, Sanders PR, Lloyd A, Hoffmann N. Inheritance of functional foreign genes in plants. Science. 1984;223:496–8. . [DOI] [PubMed] [Google Scholar]
- 41. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, et al. , editors. Current Protocols in Molecular Biology. New York: Wiley-Interscience; 1987. [Google Scholar]
- 42. Sierro N, Battey JND, Ouadi S, Bakaher N, Bovet L, Willig A, et al. The tobacco genome sequence and its comparison with those of tomato and potato. Nat Commun. 2014;5:3833 10.1038/ncomms4833 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd edition ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory; 1989. [Google Scholar]
- 44. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–25. . [DOI] [PubMed] [Google Scholar]
- 45. Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution; international journal of organic evolution. 1985;39:783–91. [DOI] [PubMed] [Google Scholar]
- 46. Zuckerkandl E, Pauling L. Evolutionary divergence and convergence in proteins In: Bryson V, Vogel HJ, editors. Evolving Genes and Proteins Academic Press, New York; 1965. p. 97–166. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Lanes 1, 2, R. etli carrying p42a with mutant virG (virGmut). Lanes 3, 4, R. etli carrying p42a with mutant virE2 (virE2mut). DNA samples were amplified with forward primers specific for the 5’-end of virG (lanes 1, 2) or virE2 (lanes 3, 4) and reverse primers specific either for the 5’-end of gusA (lanes 1, 3) or the 3’-end of gusA (lane 2, 4). Lane M, molecular size markers.
(PPTX)
Gray shading indicates proteins essential for Agrobacterium tumorigenicity [23]. OLN, ordered locus name represents the naming system for sequential assignment of an identifier to each predicted gene of a completely sequenced genome (http://www.uniprot.org/help/gene_name). Percentage of identity (Identity %) and percentage of query cover (Query Cover %) are indicated. Protein sequences were compared using the blastp program (PubMed) with the corresponding protein sequences of Agrobacterium tumefaciens strain C58 as reference. NS = no proteins with significant homology were identified.
(DOCX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.





