TABLE 3.
Organization of the HCoV-OC43 genome
| Genome region | Location (nt) | TRS location (nt) | TRS sequencea |
|---|---|---|---|
| Leader and 5′UTR | 1-209 | 63-69 | UCUAAAC. . .139 nt. . .AUG |
| ORF1a | 210-13361 | ||
| ORF1bb | 13361-21496 | ||
| Intergenic region | 21497-21505 | ||
| ns2 gene | 21506-22342 | 21492-21498 | UCUAAACUUUAAAAAUG |
| Intergenic region | 22343-22353 | ||
| HE gene | 22354-23628 | 22339-22344 | UUAAACUCAGUGAAAAUG |
| Intergenic region | 23629-23642 | ||
| S gene | 23643-27704 | 23636-23642 | UCUAAACAUG |
| Intergenic region | 27705-27791 | ||
| ns12.9 gene | 27792-28121 | 27771-27777 | UCUUAAGGCCACGCCCUAUUAAUG |
| E genec | 28108-28362 | ||
| Intergenic region | 28363-28376 | ||
| M gene | 28377-29069 | 28367-28373 | UCCAAACAUUAUG |
| Intergenic region | 29070-29078 | ||
| N gene | 29079-30425 | 29065-29070 | UCUAAAUUUUAAGGAUG |
| 3′UTR | 30426-30713 | ||
| Poly(A) tail of 28 nt | 30714-30741 |
a
Nucleotides in boldface indicate TRS sequences, whereas underlined nucleotides indicate the initiation codon.
b
Putative ribosomal −1 frameshift between ORF1a and ORF1b.
c
ORF overlap for the ns12.9 gene and the E gene.