. 2016 Feb 24;113(10):2648–2653. doi: 10.1073/pnas.1522966113

Table S2.

Primers and corresponding cycle profiles used in the experiments

Primer name	Sequence
Primers for real-time PCR of A. thaliana PR1^*	5′- AACTACAACTACGCTGCGAACAC -3′;
Primers for real-time PCR of A. thaliana PR1^*	5′- CTTCTCGTTCACATAATTCCCAC -3′
Primers for real-time PCR of A. thaliana PR2^*	5′- CGCCCAGTCCACTGTTGATA -3′;
Primers for real-time PCR of A. thaliana PR2^*	5′- ACCACGATTTCCAACGATCC -3′
Primers for real-time PCR of A. thaliana UBQ10^*	5′- GGCCTTGTATAATCCCTGATGAATAAG -3′;
Primers for real-time PCR of A. thaliana UBQ10^*	5′- AAAGAGATAACAGGAACGGAAACATAGT -3′
Primers for amplifying the amino-terminal part with a EcoRI site in front of the start codon up to the G4-mutated region of OsYchF1^†	5′- AGTGAATTCATGCCGCCCAAGGCGTCCAAG -3′
	5′- CCTTATCACTCTTGTTCACC -3′
Primers for amplifying the carboxyl-terminal part from the G4-mutated region of OsYchF1 with a SalI site added after the stop codon^†	5′- GGTGAACAAGAGTGATAAGG -3′
	5′- CCGTCGACTCACTTCTTTCCACCTCCAGAC -3′
Primers for cloning AtYchF1 (AT1G30580)	5′- ATCTAGAATGCCTCCGAAAGCCAAAGC -3′
Primers for cloning AtYchF1 (AT1G30580)	5′- ACTCGAGTCATTTCTTCCCACCACC -3′
Mutagenesis primers for constructing AtYchF1-G4’	5′- CTCTGTCATTCTTGTTAATC -3′
Mutagenesis primers for constructing AtYchF1-G4’	5′- GATTAACAAGAATGACAGAG -3′
Primers for real-time PCR of Atrd22 (At5g25610)	5′- CCCTTTCGTGTATAACTATGC -3′
Primers for real-time PCR of Atrd22 (At5g25610)	5′- ACCATCCTCAGCGTTAAACC -3′
Primers for real-time PCR of Atrd29a (At5g52310)	5′- GACTTTGACTCTGTTCTCGGTA -3′
Primers for real-time PCR of Atrd29a (At5g52310)	5′- TTTTCCAGCTCAGCTCCT -3′

Real-time PCR cycling: 95 °C for 5 min; 40 cycles of 95 °C for 10 s, 60 °C for 30 s.

^{^†}

The amino and carboxyl terminals of G4-mutated OsYchF1 were amplified by PCR separately: 94 °C for 5 min; 30 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min 30 s; an additional polymerization step at 72 °C for 10 min. PCR products were then pooled and further amplified by adding forward and reverse primers with EcoRI and SalI sites with the same cycle profile. PCR products were finally purified and cloned into the EcoRV site of pBluescript KSII (+) via the TA cloning technique. Subsequently, an EcoRI/SalI-digested fragment was released and subcloned into pGex-4T-1 to form an in-frame fusion between OsYchF1-G4′ and the GST tag. For transformation into A. thaliana or BY2 cells, the OsYchF1-G4′ fragment in pBluescript KSII (+) was released by cutting with XhoI and XbaI and subcloned into the binary vector.