Table 1.

Primers and amplification conditions used for PCR

Primer	Oligonucleotide sequence (5′–3′)	Gene	Amplification conditions	Product size (bp)	References
P90, P91	GTTCGGGGCCGTCGCTTAGG, GAGGTCGATCGCCCACGTGA	IS900	95 °C for 5 min, then 34 cycles of 95 °C for 1 min, 58 °C for 1.5 min, 72 °C for 1.5 min. Final extension of 10 min at 72 °C	398	Naser et al. [3]
AV1, AV2	ATGTGGTTGCTGTGTTGGATGG, CCGCCGCAATCAACTCCAG	IS900	95 °C for 5 min, then 34 cycles of 95 °C for 1 min, 58 °C for 1.5 min, 72 °C for 1.5 min. Final extension of 10 min at 72 °C	298	Naser et al. [3]