TABLE 1.
Primers Detection of Rabies Virus by Polymerase Chain Reaction
Designation ID | Broadly Reactive or Degenerate Primers
|
|||
---|---|---|---|---|
Orientation | Genome Position* | Sequence | Reference | |
001 | Forward | 1–16 | ACGCTTAACGAMAAA | 13 |
550 F† | Forward | 647–666 | ATGTGYGCTAAYTGGAGYAC | 13 † |
550B | Reverse | 647–666 | GTRCTCCARTTAGCRCACAT | 13 |
1087Sdeg | Forward | 1157–1173 | GAGAARGAACTTCARGA | 11 |
1066 deg F | Forward | 1136–1155 | GARAGAAGATTCTTCAGRGA | 11 |
1066deg B† | Reverse | 1136–1155 | TCYCTGAAGAATCTTCTYTC | 11† |
304‡ | Reverse | 1514–1533 | TTGACGAAGATCTTGCTCAT | 14 |
504S‡ | Forward | 1296–1312 | TCATGATGAATGGAGGT | 11 |
According to the full genome sequence of the fixed rabies virus strain, SAD B19 (Conzelmann et al. Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19. Virology. 1990;175:485–499.
Nondegenerate primers.
Reverse complement of a published primer.