Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequence of SCAR markers designed from 0.6 kb amplicon.
| Name of SCAR | Name of fragments | Sequence (5′-3′) | Total length | Temp. | Size (bp) |
|---|---|---|---|---|---|
| Sc2P | Sc2P (F) | GTACCCAATGTAGTAATATTCC | 22 bases | 60°C | 491 |
| Sc2P (R) | TAGTTAGTTTGATGACCATCACA | 23 bases | 62°C | ||
|
| |||||
| Sc2Pm | Sc2P (F) | GTACCCAATGTAGTAATATTCC | 22 bases | 60°C | 570 |
| Sc2Pm (R) | GTGTGCCCCATTCAACCAAT | 20 bases | 60°C | ||
