Skip to main content
Journal of Cancer Prevention logoLink to Journal of Cancer Prevention
. 2016 Mar 30;21(1):66–72. doi: 10.15430/JCP.2016.21.1.66

Ethanol Extract of Cirsium japonicum var. ussuriense Kitamura Exhibits the Activation of Nuclear Factor Erythroid 2-Related Factor 2-dependent Antioxidant Response Element and Protects Human Keratinocyte HaCaT Cells Against Oxidative DNA Damage

Ok-Kyung Yoo 1, Bu Young Choi 2, Jin-Oh Park 3, Ji-Won Lee 4, Byoung-Kwon Park 4, Chul Gue Joo 3, Hyo-Jung Heo 4, Young-Sam Keum 1,✉
PMCID: PMC4819669  PMID: 27051652

Abstract

Keratinocytes are constantly exposed to extracellular insults, such as ultraviolet B, toxic chemicals and mechanical stress, all of which can facilitate the aging of keratinocytes via the generation of intracellular reactive oxygen species (ROS). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that plays a critical role in protecting keratinocytes against oxidants and xenobiotics by binding to the antioxidant response element (ARE), a cis-acting element existing in the promoter of most phase II cytoprotective genes. In the present study, we have attempted to find novel ethanol extract(s) of indigenous plants of Jeju island, Korea that can activate the Nrf2/ARE-dependent gene expression in human keratinocyte HaCaT cells. As a result, we identified that ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) elicited strong stimulatory effect on the ARE-dependent gene expression. Supporting this observation, we found that ECJUK induced the expression of Nrf2, hemoxygenase-1, and NAD(P)H:quinone oxidoreductase-1 and this event was correlated with Akt1 phosphorylation. We also found that ECJUK increased the intracellular reduced glutathione level and suppressed 12-O-tetradecanoylphorbol acetate-induced 8-hydroxyguanosine formation without affecting the overall viability. Collectively, our results provide evidence that ECJUK can protect against oxidative stress-mediated damages through the activation of Nrf2/ARE-dependent phase II cytoprotective gene expression.

Keywords: Ethanol extract of Cirsium japonicum var. ussuriense Kitamura, Reactive oxygen species, Nuclear factor erythroid 2-related factor 2, Antioxidant response elements

INTRODUCTION

Oxidative stress, caused by an imbalance between the production and destruction of reactive oxygen species (ROS), is responsible for various pathological disorders in human.1 Efficient ROS detoxification is particularly considered important in keratinocytes because they are constantly challenged by extracellular oxidants and electrophiles.2 To combat against these insults, keratinocytes possess diverse antioxidants, such as ascorbic acid (vitamin C), tocopherol (vitamin E), and reduced glutathione (GSH).3 In addition, keratinocytes are equipped with a number of phase II cytoprotective enzymes as well, such as hemoxygenase-1 (HO-1), NAD(P)H:quinone oxidoreductase 1 (NQO1) and glutamate- cysteine ligases (GCLs), all of which contribute to maintaining the redox balance in keratinocytes through diverse mechanisms of action.4

Transcription of phase II cytoprotective enzymes are under the control of a single transcription factor, nuclear factor erythroid 2-related factor 2 (Nrf2).5 Under normal condition, Kelch-like ECH-associated protein 1 (Keap1) retains Nrf2 in the cytoplasm and constantly targets it for poly-ubiquitination and proteasomal degradation.6 In response to oxidative or electrophilic stress, however, Nrf2 is released from Keap1 and translocates into the nucleus, where it binds to and activates the antioxidant response element (ARE), a cis-acting DNA element located in the promoter of most phase II cytoprotective enzymes.7 Follow- up mechanism-based studies have demonstrated that the Nrf2/ARE-dependent phase II cytoprotective gene activation can occur via two ways: (1) a direct conjugation and subsequent inactivation of Keap1 by oxidants or electrophiles or (2) phosphorylation of intracellular signaling pathways leading to Nrf2 transactivation.8

Plants are the most utilized natural resources due to their abundance and accessibility.9 Therefore, exploring novel plant ingredients or extracts that can activate the Nrf2/ ARE-dependent gene expression has been recently proposed as an efficient strategy to inhibit or delay the rate of aging and carcinogenesis progression. In the present study, we have acquired 100 ethanol extracts of indigenous plants of Jeju island, Korea and attempted to find new ethanol extract(s) that can stimulate the Nrf2/ARE-dependent gene expression.

MATERIALS AND METHODS

1. Cell culture, chemicals and reagents

Ethanol extracts of 100 indigenous plants of Jeju island (Table 1) were directly purchased from Jeju Technopark (Jeju, Korea). RPMI-1640 medium, heat-inactivated FBS, PBS, and 100× penicillin/streptomycin (Pen/Strep) were purchased from Welgene (Daegu, Korea). Human keratinocyte HaCaT cells were cultured in RPMI-1640 medium, containing 10% heat-inactivated FBS and 1× Pen/Strep at 37°C in humidified 5% CO2 incubator. Polyclonal antibodies against HO-1 and NQO1 were purchased from Enzo Life Sciences (Farmingdale, NY, USA) and Abcam (Cambridge, MA, USA), respectively. Primary antibody against Nrf2 and horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Bovine serum albumin (BSA), MTT and primary antibodies against 8’-hydroxyguanosine (8-OH-G) and actin were purchased from Sigma (St. Louis, MO, USA). Total and phospho-specific Akt1 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). Fluorescein isothiocyanate (FITC)-conjugated secondary antibody was purchased from Jackson ImmunoResearch (West Grove, PA, USA). Paraformaldehyde, bicinchoninic acid (BCA) protein assay kit, and polyvinylidene fluoride (PVDF) membranes were purchased from Millipore (Billerica, MA, USA). pGreenFire reporter plasmid was purchased from System Biosciences (Mountain View, CA, USA). pMD2.G and psPAX.2 lentiviral helper plasmids were acquired from Addgene (Cambridge, MA, USA).

Table 1.

List of ethanol extract of indigenous plants from Jeju island, Korea No.

No. Extract No. Extract
1 Euphorbia jolkini Boiss 51 Wistaria floribunda A.P. DC
2 Raphanus sativus var. hortensis f. raphanistroides Makino 52 Paliurus ramosissimus (Lour)
3 Korthalsella japonica Engl. 53 Hibiscus hamabo S. et Z
4 Neolitsea sericea (BL.) Koidz. 54 Callicarpa japonica Thunb
5 Cinnamomum japonicum Sieb. 55 Torreya nucifera S. et Z
6 Lycopodium clavatum var. nipponicum Nakai 56 Sapindus mukorossi Gaertner
7 Stauntonia hexaphylla (Thunb.) Decne. 57 Meliosma oldhamii Miq
8 Pyrrosia lingua (Thunb.) Farwell 58 Rhus chinensis Mill.
9 Cyrtomium falcatum (L.) Presl 59 Corylus sieboldiana Bl.
10 Hedera rhombea (Miq.) Bean 60 Albizzia julibrissin Durazz
11 Gleichenia japonica Spreng 61 Xylosma congestum (Lour.) Merr.
12 Neolitsea aciculata (Bl.) Koidz. 62 Ulmus davidiana var. japonica (Rehder) Nakai
13 Fatsia japonica Decne. et Planch. 63 Zanthoxylum ailanthoides S.
14 Cyclosorus acuminatus (Houtt.) Nakai ex H.Ito 64 Actinodaphne lancifolia (S. et Z) Meisn
15 Eribotrya japonica Lindl. 65 Celtis sinensis Pers
16 Machilus thunbergii S. et Z. 66 Sapium sebiferum (L.) ROXB.
17 Actinodaphne lancifolia (S. et Z.) Meisn 67 Securinega suffruticosa Rehder.
18 Buxus microphylla var. koreana Nakai 68 Kalopanax pictus (Thunb.) Nakai
19 Ternstroemia japonica Thunb. 69 Caragana sinica (Buchoz) Rehder
20 Citrus junos Sieb. ex Tanaka 70 Oenothera odorata Jacq.
21 Daphniphyllum macropodum D. glaucescens Blume 71 Platycodon grandiflorum (Jacq.) A. DC.
22 Ilex crenata Thunb. var. convexa Makino 72 Ampelopsis brevipedunculata var. heterophylla (Thunb.) Hara
23 Ligustrum lucidum Ait. 73 Cirsium japonicum var. ussuriense Kitamura
24 Cinnamomum camphora Sieb. 74 Platanus orientalis L.
25 Pittosporum tobira Ait. 75 Oenothera erythrosepala Borbas
26 Ilex crenata var. microphylla Max. 76 Euphorbia supina Rafin.
27 Citrus tangerina Hort.ex Tanaka 77 Plantago asiatica L.
28 Vicia angustifolia var. segetilis K. Koch. 78 Aleurites fordii Hemsl.
29 Brassica campestris subsp. napus var. nippo-oleifera Makino 79 Euphorbia humifusa Willd.
30 Artemisia fukudo Makino 80 Vicia unijuga A. Br.
31 Lathyrus japonica Willd. 81 Loranthus yadoriki Sieb.
32 Sonchus oleraceus L. 82 Solanum nigrum L.
33 Rosa multiflora Thunb. 83 Brassica juncea var. integrifolia Sinsk.
34 Atremisia sp. 84 Daphniphyllum macropodum Miq.
35 Asparagus cochinchinensis Merr. 85 Ligustrum lucidum Ait.
36 Rumex acetocella L. 86 Cayratia japonica (Thunb.) Gagnepain
37 Angelica japonica A. Gray 87 Broussonetia papyrifera (L.) L’ Heriter ex Ventenat
38 Lindera erythrocarpa Makino 88 Sasa palmata (Bean) Nakai
39 Acer mono Max. 89 Kadsura japonica (L.) Dunal
40 Akebia quinata DECNE. 90 Vaccinium bracteatum Thunb.
41 Saururus chinensis Baill. 91 Sedum bulbiferum Makino
42 Acanthopanax koreanum Nakai 92 Persicaria sp.
43 Pteridium aquilinum var. latiusculum (Desv.) Underw. 93 Eupatorium lindleyanum DC.
44 Plantago lanceolata L. 94 Sapium japonicum (Sieb. et Zucc.) Pax et Hoffmann
45 Cornus controversa Hemsl. 95 Maackia fauriei (Lev.) Takeda
46 Cudrania tricuspidata (Carr.) Bureau ex Lavallee 96 Dendropanax morbiferum Leveille
47 Actinidia arguta Planch. 97 Gleditsia japonica var. koraiensis (Nak.) Nakai
48 Clerodendron trichotomum Thunb. 98 Euphorbia esula L.
49 Boehmeria pannosa Nakai et Satake 99 Oenothera laciniata Hill.
50 Eribotrya japonica Lindl. 100 Litsea japonica (Thunb.) Juss.

2. Generation of HaCaT-antioxidant response element-luciferase cells and measurement of luciferase activity

In order to generate HaCaT-ARE-luciferase reporter cells, we have subcloned 3× tandem ARE oligonucleotides (CACCGTGACTCAGGAATTCACCGTGACTCAGGAATT CACCGTGACTCAGGAATT with a core DNA sequence of ARE underlined) into pGreenFire reporter plasmid. 293T cells were then transfected with 3 μg pGreenFire-ARE plasmid together with 3 μg pMD2.G and 3 μg psPAX.2 plasmids, using JetPEI reagent (Polyplus-Transfection, New York, NY, USA). After 72 hours, lentiviral supernatant was collected and filtered, using a 0.45 μm syringe filter. HaCaT cells were transduced with lentiviral supernatant containing 10 μg/mL polybrene for 12 hours at 37°C and further selected with 3 μg/mL puromycin for 48 hours. Established HaCaT-ARE-luciferase cells were seeded on 70% confluence in six-well plate and exposed to individual plant ethanol extracts at the concentration of 200 μg/mL. After 24 hours, cells were lysed with luciferase lysis buffer (0.1 M potassium phosphate buffer at pH 7.8, 1% Triton X-100, 1 mM dithiothreitol, 2 mM EDTA) and the resulting luciferase activity was measured by GLOMAX Multi-system (Promega, Madison, WI, USA). The data is depicted as a fold ratio of the firefly luciferase activity, compared with the control after normalization with protein concentration and the statistical analysis was conducted by Student t-test with n = 6.

3. Western blot analysis

After appropriate treatment, HaCaT cells were collected by centrifugation and resuspended with 200 μL RIPA buffer (50 mM Tris-HCl at pH 8.0, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, protease inhibitors cocktail) and incubated on ice for 1 hour. After collection of cell lysates by centrifugation, protein concentration was measured by BCA Protein Assay Kit (Thermo Fisher, Pittsburgh, PA, USA). Equal amounts of cell lysates were resolved by SDS PAGE and transferred to PVDF membrane. The membrane was incubated in blocking buffer (5% skim milk in 1× PBS-0.1% Tween-20, PBST) for 1 hour and hybridized with the appropriate primary antibodies in 1× PBS containing 3% BSA (in the case of phospho-specific Akt1) or 3% skim milk (in the case of total proteins) overnight at 4°C. After washing three times with 1× PBST for 30 minutes, the membrane was hybridized with appropriate HRP-conjugated secondary antibody for 1 hour at room temperature and washed three times with 1× PBST solution for 30 minutes. The membrane was visualized by using an enhanced chemiluminescence detection system. Actin blot was used as control for an equal loading of samples.

4. Determination of intracellular reduced glutathione level

The intracellular GSH level was measured using reduced glutathione detection kit as recommended by the manufacturer (Enzo Life Sciences).

5. MTT assay

HaCaT cells (3 × 104 cells/100 μL/well) were plated in 96-well culture plates in quadruplicate. After appropriate treatment, cells were exposed to 50 μL MTT stock solution (2 mg/mL) for 4 hours. HaCaT cells were then washed with 1× PBS and lysed with 50 μL DMSO. Measurement using spectrophotometer was conducted at the wavelength of 540 nm and the percentage of viable cells was plotted in comparison with the control group.

6. Detection of intracellular 8-hydroxyguanosine level

In order to measure the changes in the intracellular 8-OH-G level, HaCaT cells grown on a slice glass were incubated with blocking serum (1% BSA) for 30 minutes. After washing with 1× PBS three times, cells were hybridized with primary antibody against 8-OH-G overnight at 4°C. After washing with 1× PBS three times, the slides were probed with FITC-conjugated rabbit secondary antibody and the fluorescent images were obtained with a C2 confocal microscope (Nikon Korea, Seoul, Korea).

RESULTS

1. Identification of ethanol extract of Cirsium japonicum var. ussuriense Kitamura as a novel inducer of antioxidant response element-dependent gene expression

To find out novel plant extracts that stimulate the ARE-dependent gene expression among ethanol extracts of 100 indigenous plants of Jeju island, Korea, we have exposed HaCaT ARE luciferase cells to individual natural extracts at the concentration 200 μg/mL for 24 hours and measured the resulting luciferase activity. While many extracts exhibited stimulatory or inhibitory effects on ARE-dependent luciferase activation, we observed that ethanol extract of C. japonicum var. ussuriense Kitamura (ECJUK; No. 73) exerted particularly strong stimulatory effect, whose ARE activation level was equivalent to that by 10 μM sulforaphane, a positive control in the experiment (Fig. 1A). Supporting this observation, an exposure to ethanol extract of ECJUK caused a concentration-dependent ARE-dependent gene activation in HaCaT ARE-luciferase cells (Fig. 1B). These results illustrate that ECJUK possesses strong stimulatory effect on ARE-dependent gene expression.

Figure 1.

Figure 1.

Ethanol extract of Cirsium japonicum var. ussuriense Kitamura (ECJUK) induces antioxidant response element (ARE)-dependent gene expression in HaCaT cells. (A) Effects of ethanol extracts of 100 indigenous plants from Jeju island, Korea on the ARE-dependent luciferase activity in HaCaT ARE-luciferase cells. (B) Concentration-dependent increase in ARE-dependent luciferase activity in HaCaT-ARE-luciferase cells after ECJUK treatment. After an exposure of various concentrations of ECJUK to HaCaT-ARE-luciferase cells, the luciferase assay was conducted as described. Sulforaphane (SFN) was used as a positive control. The data is depicted as a fold ratio of the firefly luciferase activity, compared with the control group and statistical analysis was conducted by Student t-test with n = 6. Symbols indicate a statistically significance with **P < 0.01 and ***P < 0.001.

2. Cirsium japonicum var. ussuriense Kitamura induces the expression of phase II cytoprotective enzymes in HaCaT cells through nuclear factor erythroid 2-related factor 2-dependent transcriptional activation

We next examined whether ECJUK could induce the expression of Nrf2 and phase II cytoprotective enzymes in HaCaT cells. To this end, HaCaT cells were exposed to ECJUK at various times and Western blotting was conducted. As a result, we observed that ECJUK induced the expression of Nrf2 and phase II cytoprotective enzymes (HO-1 and NQO1). The induction of Nrf2, HO-1, and NQO1 was closely associated with phosphorylation of Akt1 (Fig. 2A), a putative kinase that positively regulates the ARE-dependent gene expression.10 Real-time RT-PCR analysis illustrated that ECJUK stimulated transcription of HO-1 and NQO1 in HaCaT cells. Together, these results suggest that ECJUK induces Nrf2-dependent HO-1 and NQO1 expression, possibly via Akt1 phosphorylation.

Figure 2.

Figure 2.

Nuclear factor erythroid 2-related factor 2 (Nrf2) induction of phase II cytoprotective enzymes by Cirsium japonicum var. ussuriense Kitamura (ECJUK) is mediated at the transcription level. (A) After an exposure of ECJUK to HaCaT cells, cell lysates were collected and Western blot analysis was conducted using appropriate antibodies. (B) After an exposure of ECJUK to HaCaT cells, the real-time RT-PCR was performed to measure the resulting hemoxyge-nase-1 (HO-1) and NAD [P]H:quinone oxidoreductase-1 (NQO1) mRNA levels. The data is depicted as a fold ratio of mRNA level, compared with the control group and statistical analysis was conducted by Student t-test. Symbols indicate a statistically significance with **P < 0.01 and ***P < 0.001.

3. Cirsium japonicum var. ussuriense Kitamura increases the amount of intracellular reduced glutathione and protects against ultraviolet B-mediated DNA damage

In addition to HO-1 and NQO1, Nrf2 is also responsible for transcriptional activation of GCL that boosts up the intracellular GSH level in response to oxidative stress. Therefore, we examined whether ECJUK could increase the intracellular GSH level in HaCaT cells. As a result, we found that ECJUK did not affect the overall viability of HaCaT cells (Fig. 3A). However, it significantly increased the intracellular GSH level (Fig. 3B) and inhibited 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced 8-OH-G formation (Fig. 3C). Overall, our results imply that ECJUK can activate ARE and increase the expression of Nrf2-dependent phase II cytoprotective enzymes, thereby contributing to maintaining the genome integrity against oxidative DNA damages.

Figure 3.

Figure 3.

Cirsium japonicum var. ussuriense Kitamura (ECJUK) increases the intracellular reduced glutathione (GSH) level and protects HaCaT cells against oxidative DNA damage. After an exposure of ECJUK to HaCaT cells, (A) MTT assay was conducted to measure the cell viability and (B) the intracellular GSH level was measured as described. Symbols indicate a statistically significance with ***P < 0.001. (C) After an exposure of ECJUK to HaCaT cells, the intracellular 8-hydroxyguanosine (8-OH-G) level was visualized by immunofluorescence (IF) assay, using 8-OH-G antibody. TPA, 12-O-tetradecanoylphorbol-13-acetate; DAPI, 4′,6-diamidino-2-phenylindole.

DISCUSSION

Because Nrf2 activation plays a key role in the protection against oxidative stress, it was surmised that finding out novel compounds that can boost up the Nrf2 activity might be useful for treatment of pro-inflammatory diseases. In this sense, two recent clinical trials showed a simultaneous failure and success of Nrf2 activators as potential drug candidates.11 Because the methyl ester derivative of the synthetic triterpenoid, 2-cyano-3, 12-dioxooleana-1,9(11)-dien-28-oic acid (CDDO-Me) induces Nrf2 at low nanomolar concentrations, it underwent an initial development as a promising drug candidate under the generic name, bardoxolone methyl for treatment of advanced chronic kidney disease and type-2 diabetes mellitus. However, this clinical trial was terminated in the phase III phase for safety concerns. On the other hand, dimethylfumarate, a synthetic Nrf2 activator, has been developed for treatment of multiple sclerosis (MS) and recently approved by the Food and Drug Administration under the trade name of Tecfidera.

In the present study, we have identified ECJUK possesses significant stimulatory effect on the Nrf2/ARE-dependent gene expression in HaCaT-ARE-luciferase reporter cells (Fig. 1). We also showed that ECJUK increased the expression of Nrf2 and phase II cytoprotective enzymes, e.g., HO-1 and NQO1 (Fig. 2) and that it protected against TPA-induced oxidative DNA damage in HaCaT cells (Fig. 3). Previous studies have demonstrated that C. japonicum induced adipocyte differentiation12 and exhibited pro-apoptotic effects in MCF-7 cells.13 Although detailed mechanisms of action of C. japonicum extract are currently unknown, it is possible that the above-mentioned biological effects could be mediated by Nrf2/ARE-dependent molecular mechanisms. A recent activity-guided fractionatons by Lai et al.14 have identified phenylacrylic acid esters and new polyacetylenes existing in C. japonicum var. australe as major constituents. In another study, Zhang et al.15 have conducted LC–MS/MS determination and identified seven flavonoids, including pectolinarin, linarin, pectolinarigenin, hispidulin, diosmetin, acacetin, and apigenin in rat plasma after oral administration of C. japonicum DC. extract. At present, we are unaware which compounds primarily exist in ECJUK and the activity-guided fractionation is necessary to identify the lead compound(s) contributing to the Nrf2/ARE-dependent gene expression in ECJUK.

Acknowledgments

This work was supported by Bio-Theme Cluster program of Korea Industrial Complex Corp. (KICOX) (THMSD02R02).

Footnotes

CONFLICTS OF INTEREST

No potential conflicts of interest were disclosed.

REFERENCES

  • 1.Circu ML, Aw TY. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic Biol Med. 2010;48:749–62. doi: 10.1016/j.freeradbiomed.2009.12.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Surh YJ, Kundu JK, Na HK. Nrf2 as a master redox switch in turning on the cellular signaling involved in the induction of cytoprotective genes by some chemopreventive phytochemicals. Planta Med. 2008;74:1526–39. doi: 10.1055/s-0028-1088302. [DOI] [PubMed] [Google Scholar]
  • 3.Kohen R, Nyska A. Oxidation of biological systems: oxidative stress phenomena, antioxidants, redox reactions, and methods for their quantification. Toxicol Pathol. 2002;30:620–50. doi: 10.1080/01926230290166724. [DOI] [PubMed] [Google Scholar]
  • 4.Kensler TW, Wakabayashi N, Biswal S. Cell survival responses to environmental stresses via the Keap1-Nrf2-ARE pathway. Annu Rev Pharmacol Toxicol. 2007;47:89–116. doi: 10.1146/annurev.pharmtox.46.120604.141046. [DOI] [PubMed] [Google Scholar]
  • 5.Sykiotis GP, Bohmann D. Stress-activated cap‘n’collar transcription factors in aging and human disease. Sci Signal. 2010;3:re3. doi: 10.1126/scisignal.3112re3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Keum YS. Regulation of Nrf2-Mediated Phase II Detoxification and Anti-oxidant Genes. Biomol Ther (Seoul) 2012;20:144–151. doi: 10.4062/biomolther.2012.20.2.144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Itoh K, Wakabayashi N, Katoh Y, Ishii T, Igarashi K, Engel JD, et al. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 1999;13:76–86. doi: 10.1101/gad.13.1.76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Niture SK, Khatri R, Jaiswal AK. Regulation of Nrf2-an update. Free Radic Biol Med. 2014;66:36–44. doi: 10.1016/j.freeradbiomed.2013.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chinembiri TN, du Plessis LH, Gerber M, Hamman JH, du Plessis J. Review of natural compounds for potential skin cancer treatment. Molecules. 2014;19:11679–721. doi: 10.3390/molecules190811679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Keum YS. Regulation of the Keap1/Nrf2 system by chemopreventive sulforaphane: implications of posttranslational modifications. Ann N Y Acad Sci. 2011;1229:184–9. doi: 10.1111/j.1749-6632.2011.06092.x. [DOI] [PubMed] [Google Scholar]
  • 11.Keum YS, Choi BY. Molecular and chemical regulation of the Keap1-Nrf2 signaling pathway. Molecules. 2014;19:10074–89. doi: 10.3390/molecules190710074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Liao Z, Wu Z, Wu M. Cirsium japonicum flavones enhance adipocyte differentiation and glucose uptake in 3T3-L1 cells. Biol Pharm Bull. 2012;35:855–60. doi: 10.1248/bpb.35.855. [DOI] [PubMed] [Google Scholar]
  • 13.Kim DY, Kang SH, Ghil SH. Cirsium japonicum extract induces apoptosis and anti-proliferation in the human breast cancer cell line MCF-7. Mol Med Rep. 2010;3:427–32. doi: 10.3892/mmr_00000275. [DOI] [PubMed] [Google Scholar]
  • 14.Lai WC, Wu YC, Dankó B, Cheng YB, Hsieh TJ, Hsieh CT, et al. Bioactive constituents of Cirsium japonicum var. australe. J Nat Prod. 2014;77:1624–31. doi: 10.1021/np500233t. [DOI] [PubMed] [Google Scholar]
  • 15.Zhang Z, Jia P, Zhang X, Zhang Q, Yang H, Shi H, et al. LC-MS/MS determination and pharmacokinetic study of seven flavonoids in rat plasma after oral administration of Cirsium japonicum DC. extract. J Ethnopharmacol. 2014;158(Pt A):66–75. doi: 10.1016/j.jep.2014.10.022. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Cancer Prevention are provided here courtesy of Korean Society of Cancer Prevention

RESOURCES