| Alkaline phosphatase forward primer: | 5′ GCTGATCATTCCCACGTTTT |
| Alkaline phosphatase reverse primer: | 5′ CTGGGCCTGGTAGTTGTTGT |
| Osteocalcin forward primer: | 5′ AAGCAGGAGGGCAATAAGGT |
| Osteocalcin reverse primer: | 5′ TTTGTAGGCGGTCTTCAAGC |
| Type I collagen forward primer: | 5′ CAGGGAAGCCTCTTTCTCCT |
| Type I collagen reverse primer: | 5′ ACGTCCTGGTGAAGTTGGTC |
| GAPDH forward primer: | 5′ CGTGGGGCTGCCCAGAACAT |
| GAPDH reverse primer: | 5′ TCTCCAGGCGGCACGTCAGA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.